JoNova
A science presenter, writer, speaker & former TV host; author of The Skeptic's Handbook (over 200,000 copies distributed & available in 15 languages).
Jo appreciates your support to help her keep doing what she does. This blog is funded by donations. Thanks!
Follow Jo's Tweets To report "lost" comments or defamatory and offensive remarks, email the moderators at: support.jonova AT proton.me
Statistics
The Australian newspaper today (Thursday) …
“The move by Scott Morrison to end The Australian Renewable Energy Agency’s strict rules on funding only wind and solar projects comes with a $1.9 billion budget boost to invest in new technologies including carbon capture and storage, soil carbon, hydrogen and green steel.”
“The Clean Energy Finance Corporation will also have its mandate expanded beyond “clean energy” – primarily wind, solar and gas – to include future low-emissions energy technologies which could lower emissions from manufacturing, agriculture and transport.”
“The proposed changes set the scene for a second climate battlefront with Labor over the agencies’ roles, since Tony Abbott tried to scrap ARENA in 2014.”
When will these dolts wake up to the fact that CO2 is essential for life and is not “carbon pollution”?
And that coal remains a valuable viable source of fuel for baseload generators in power stations? Look at the world and the continuing construction of HELE technology power stations.
As Terry McCrann points out in The Daily telegraph today: “Well, this week, not only did the Brits go back to colt keep the lights on – and they baked in a mid-20s “heatwave”, the zircons as well – they really shovelled some coal. For a whole day or two they actually got more electricity from coal than from. oh dear, wind. At its peak this week, the UK was getting nearly 3,000 MW from coal, well more than three times the 800 MW or so coming from all those wind turbines, both those that despoil the British landscape and those parked equally hideously offshore.”
…………. “This week the UK was getting a similar amount of power from coal as from so called “biomass” – that is burning wood chips in what used to be a coal fired power station.”
He pointed out that most of the electricity used in the UK comes from coal, gas and nuclear fuels.
160
Dennis:
I reckon it will take at least as long as it will take them to realise a vaccine for Covid 19 is also not necessary.
Cordoba University, Spain, has found a cure. See Jo’s post from last week:
Vitamin D reduced the rate of ICU admission from 50% to 2%. Do black lives matter? 2020/9/12
Jo cites/quotes a paper from Cordoba University citing Cholecalciferol (vitamin D 3) in the form of calcidiol (the serum form of vit D 3), with Hydroxy Chloroquine and Zinc as “a best hospital treatment.” It’s effectively a cure —not immediate but remember: the `cure’ was administered to the ill when they arrived at hospital, not before. A 2% failure is marvellous.
It’s a cure.
No need to waste billions of bucks into Bill Gates voracious pockets nor to kill hundreds or thousands of citixens by making them wait for a vaccine.
120
“Green steel” is the latest Leftist economy-destroying fantasy.
It involves using supposedly green hydrogen for the chemical reduction of iron ore rather than carbon in the form of carbon monoxide from coal.
It represents a lack of understanding of the chemical and economic processes involved.
Some analysis here:
https://ectltd.com.au/green-steel-articles-omit-cost/
181
BHP tried to up-grade their iron ore using hydrogen (to higher iron content hence price) but it didn’t work economically.
80
What next?
Green Cement?
40
For boots?
40
Green cement from between ears in the greenists’ heads….
22
Well the tonnes of steel reinforced concrete at the base of every wind turbine and at the base of the vast fields of frames holding up solar panels is clearly an example of green concrete.
30
My first post got lost in the ether; hope this isn’t a duplicate.
Something for people to ponder.
China has built a huge military base in the North complete with replica buildings of Taiwan’s government buildings and airport.
https://www.thedrive.com/the-war-zone/33591/chinas-biggest-base-has-huge-replicas-of-taiwans-presidential-building-and-the-eiffel-tower
60
The story reminds me of the model the Japanese constructed so that their military could practise what became a very successful invasion of Hong Kong during WW2.
The Japanese arrived by ship and used fold up rowing boats to cross a dam after climbing near vertical cliff faces and then surprised the British soldiers in their bunkers facing another direction.
70
They also built a model of Pearl Harbour, prior to the attack on Dec 6.
https://www.history.navy.mil/our-collections/photography/wars-and-events/world-war-ii/pearl-harbor-raid/japanese-forces-in-the-pearl-harbor-attack/miscellaneous-views-of-japanese-forces/NH-62534.html
10
Have they started to build similar test sites replicating Australian cities?
30
The potential strengths of China should be considered by comparing the Commonwealth of Nations member countries combined military capabilities, and even here in Australia consider the Asia Pacific countries that are not China’s allies.
During WW2 Germany was defeated because Great Britain had many allies and combined they also defeated Japan.
30
The British were also reading the German and Japanese codes. That may have shortened the War more than just significantly.
The enemy embarked on many spy hunts but never once tried attacking the output of their so wonderful machinery,
The British Colossus machines were the world’s first computers.
(Just for the nit-pickers: the 10 Colossi at Bletchley Park decoded the German High Command encrypted teletypes while Turing’s Bombes took care of the Enigma machine encoding used by the Army Navy and Air Force mobile units.)
40
Unless Boris removes his digit, and fast, don’t count on British military support for any Commonwealth action because under the Withdrawal Agreement the UK military is still subject to EU control after “full” Brexit is achieved. That comes courtesy of a secret little side-deal Theresa May did before she was ousted. That deal still stands and is bound up in the Withdrawal Agreement unless Boris gets off his duff and does something about it like he did with the Northern Ireland trade/sovereignty issue.
https://www.youtube.com/watch?v=UkPNfR3Z5Yo
Further to that, the UK military has seldom been weaker than now. They cannot recruit the numbers they need for replacements, due to their self-imposed gender, race and religious quotas. WOKE strikes again.
I believe if you’re a one-legged, transgender person of THE Faith who identifies as any colour but white, you go in at the rank of full colonel. Multiple nose piercings and neck tattoos are also an advantage.
100
Or…the UK army has been white anted by globalist lapdog politicians…
I tell you, there will be a Nuremberg Trial for *all* NWO globalists when this is all over.
The look on thier faces when they come face to face with thier prison cells will be worth it.
Untouchable….? Nope…
41
Beowulf
I think you will find this is a misunderstanding as any UK involvement in EU defence projects is strictly on a case by case basis, we are not tied into any formal agreement.
Currently we have some air forces in the Baltic states to counter the Russian threat. Details of defence arrangements are here
https://www.instituteforgovernment.org.uk/explainers/future-relationship-defence-security-cooperation
The article also describes our armed forces. It is true they are the smallest since 1900 at some 144,000 but that is because we have no empire to defend nor are involved in any wars. We are arguably western europes foremost armed force, are one of the few to meet our NATO commitments and have the largest defence budget in the former EU 28 countries and are still capable of mounting a multi response force.
The two new aircraft careers are currently being equipped and we have signed a new agreement to have a new base in the middle east.
It is completely unthinkable that the UK would not participate in any action against forces hostile to australia. As Dennis remarks we have many allies and it is that which gives us strength so we could join with others to defeat threats. Ausyralia is a formidable force in its own right as we know from two world wars
Let’s hope it doesn’t come to any conflict with such as China and hopefully Australia will start to distance itself a bit more on trade and other areas of cooperation where china seem to have the whip hand.
40
Sorry Tonyb,
Some of us remember, or have learnt about the 1940s, when Oz had to turn to the US as UK was in enough trouble of its own. I’m sure they’d come to our aid if it were possible and suited their own agenda.
Cheers
Dave B
30
Yes, well you haven’t had an empire for a very long time and that’s not why your military is declining. Your army units are definitely struggling to maintain numbers.
“UK army combat units 40% below strength [as at August 2019] as recruitment plummets”
“Data released by the Ministry of Defence under freedom of information laws shows the number of soldiers in the British army’s infantry regiments has declined steadily over the past five years.”
https://www.theguardian.com/uk-news/2019/aug/09/uk-army-combat-units-40-below-strength-as-recruitment-plummets
British Armed Forces have retention, not recruitment crisis, new figures show — The Telegraph (paywalled)
That Institute for Government link you provided seems to give a very rosy, naive take on reality compared to the general’s take, which is not surprising as searching their website reveals a string of pro-EU and pro de-carbonising Net Zero Emissions articles. This could be the reason:
https://www.spectator.co.uk/article/revealed-the-institute-for-government-s-europhile-links
Under the Political Declaration as it stands, the UK would be tied into the EU defence structures. The Political Declaration is non-binding, but Boris has taken a half in/half out approach. To be in to any extent is to be all-in when it comes to the EU once it has its tentacles around you. The UK deep state bureaucrats who wrote the declaration are still running the show, manipulating the UK towards EU involvement in the background and stupid politicians are blind to the approaching precipice.
“The EU is not offering ad hoc involvement in EU defence bodies, it is offering attachment on the same basis and with the same expectations as member states. This means full compliance with the EU as described in the defence parts of the EU treaties, directives and EU Council agreements.”
The prime reason the EU wants to get its hooks into your UK military at all costs is precisely because it is still the best in western Europe. Germany’s own military is an embarrassment: 4 fighter jets capable of operations due to spares and ordinance shortages; one panzer grenadier unit using brooms as machine guns in a NATO exercise a couple of years ago. Dad’s Army Deutsch-style.
Any integration of UK defence with EU defence also endangers UK involvement in the 5-Eyes network exactly the same as letting Huawei into your communications network did.
Whilst you might like to come to our aid, there are no future guarantees the way things stand.
21
Beowulf
Unless the dates are wrong your links are to historic documents up to four years old.
Mine comes from a few months ago and reflects the withdrawl agreement and that we are now actually out of the EU which was not the case with your two links.
11
Um, no quite current actually.
Lt. Gen. Riley — 20/9/2019
https://www.youtube.com/watch?v=UkPNfR3Z5Yo
And his article of 20/5/2020
https://briefingsforbritain.co.uk/weakening-our-defences-dangers-in-the-political-declaration/
Good luck with that withdrawal agreement. You’ll need it unless Boris goes WTO and tells Merkel/Macron where to stick their agreement and political declaration.
20
Apropos of
beowulf
September 19, 2020 at 9:19 am
Lt Gen Riley noted in his article of May 20 that “The EU would have any discussion about these structures on its own terms or not at all” which struck me as identical to the CCP having in the Article IV Settlement of Differences of Victoria’s MOU that “The Parties will settle differences … through friendly consultations” without acknowledging that in their vocabulary “friendly” means “doing what the PRC wants”.
It’s sad to see how quickly the EU has descended into totalitarianism and the UK needs to eradicate even the minutest vestiges of its suffocating web of tethering arrangements.
10
“Have they started to build similar test sites replicating Australian cities?”
Why bother when they can phone (or fax) instructions.
40
no need, they want our resources and agriculture, the can just nuke the cities
10
They are paying top dollar for our agriculture and resources, there is no reason to think anything is going to change. Forget the nuclear war and winter aftermath, we just had a taste of how it may pan out.
One thousand specially trained agents could drop a deadly virus where ever they please.
00
I am absolutely flabbagasted at the growing story that Joe Biden is clearly suffering senile dementia. The teleprompter story is just getting bigger and bigger.
He is clearly pasty faced, feeble, trembling and even struggling for breath. People including his wife are by his side when he struggles and you can see the concern as he stumbles verbally and physically. He gets very simple statements completely wrong “and wearing masks, which I never do when I walk outside of this house”. Unbelievable. He just said the opposite of sense. Clearly he is really struggling to read the teleprompter and sometimes reads instructions as his lines and not quick enough to know the difference. He often just mumbles.
And then standing in front of a wall promotion Biden-Harris and saying Harris-Biden. On ‘climate commitments’ After nine years of coming second, he still puts himself second.
Even his wife and sister have acted as body guards.
As even Melania Trump said, “that poor man”. How long will this elder abuse last?
They have to get old Joe to the finish line and that is looking very difficult. They may have to carry him. He is staggering. He has no idea where he is, which state and which city. And he is not making sense.
I can only think they are going to slot Hillary in at the last moment. Either way we are watching a very public destruction of a man who could talk for an hour without written notes and not put a foot wrong. He is falling apart in front of the cameras. This cannot be the Democrat candidate for President of the most powerful Nation on Earth!
Most US presidents were in their 50s and a few in their early sixties. Reagan at 69 and Trump at 70 were the oldest but to promote 79 year old Joe Biden as physically and mentally fit just to start a demanding job is very wrong. He would be 83 after four years. Unless we are talking President Harris or President Pelosi or President Clinton.
181
Two errors?
Both Joe Basement and his running shadow have slipped up and referred to her future post election administration.
Maybe when the spin doctors hatched the plot they did not anticipate that Joe would lose the plot so quickly?
131
And how on earth is he going to debate Donald Trump?
Joe Biden could not be trusted to catch a taxi on his own or walk very far.
And the debate only needs three people in the room and TV cameras but I cannot imagine the Democrats could allow him to debate Trump. So wait for the excuses and Wu Flu is not an excuse. Trump would even go to his basement.
Mad Nancy (as she was called by her own tame interviewer) has already said there will be no debate, but how are they going to get away with no debate at all?
Or should Donald Trump be asked to debate a teleprompter? It’s going to be even more farcical soon. It might be only 47 days to the election, but sleepy Joe might not make it. Is it legal to have a substitute candidate, like a runner in cricket?
91
And another Biden gem. Plus some more..
21
The Democratic Party presidential campaign has come clean at last:
https://www.youtube.com/watch?v=GVbE8IowIcM
10
Perhaps Joe Biden doesn’t want to be President? After all IF he wins the poll, with Kamala Harris and Nancy Pelosi behind him he would be very lucky to make The Inauguration alive.
When the Athenian expedition against Syracuse was launched in 415 B.C. the astronomer Meton didn’t share the enthusiasm and feigned madness. His son had to stay behind to care for “poor old Dad”. Very few Athenians ever came back from Sicily. Perhaps Joe feels that it might be better to survive as the loser??
30
How will he debate? Probably with the questions leaked to him in advance and words fed via his ear or a teleprompter hidden in his lectern, I expect, like Hildabeast did – some say.
10
Yeah…Kamala Harris basiclaly let slip that she is the actual Prez candidate.
She appears so left wing, she makes Hillary look like a good deal….
60
These very short video clips of Biden are very sad and pathetic. The DemocRATS are basically engaged in elder abuse.
https://youtu.be/8SmxgG34UUw
https://youtu.be/dVCPfnbEB2I
20
I would call an ambulance. He belongs in respite, not on television. He cannot be the best candidate out of half of 320 million people.
America has so many incredible, high performing and clever people and this sick feeble old man is not one of them. Why aren’t the Democrats speaking up? Do they really want Joe Biden to be their President? What is their real intention? We can only guess.
And it is obvious that the DNC has decided Kamala Harris is to be President, not Joe Biden. Joe and Kamala have both said so, but extreme socialist Kamala Harris is unelectable, so it’s a fraud. No one expects Joe Biden to make it to the inauguration but they are too dishonest to say so. Or do they really expect to lose anyway?
Why isn’t the media saying this is utterly unacceptable? Doesn’t Biden’s Life Matter?
80
For many (perhaps most) Democrats, their TDS (Trump Derangement Syndrome) is so overpowering that they would vote for anyone who is not Donald Trump, so in that sense, it doesn’t really matter who the Democrats run as their candidate.
40
Is it possible to substitute a candidate at the last minute? Kanye West has been denied a position on the ballot in multiple States as the deadline has already passed.
10
PCR follow up.
If I provide a nostril swab to be tested using the PCR method.
The first part of the process ‘denatures’ my DNA into bits of RNA.
Others would have you believe that the strings of RNA retain cohesion.
They may say that the denature process does not destroy individual RNA sequences, so prove it.
SARS-CoV-2 is a virus, of dubious provenance and does NOT contain DNA!
So let us now apply the 30 steps to amplify and recombine that RNA into DNA with-out any additional substance, ie no target substance.
If the denatured RNA is a cohesive string then the re-combination will result in some complete DNA cells or complete DNA genes!
This is of course an act of creation well beyond a laboratory process and requires sexual re-creation a process not available to a Virus so just what is the PCR test detecting?
It therefore follows that the RNA after the denature process is a soup of RNA parts.
10
slithers it is all wrong. I’m sorry but wrong.
The first part of the process ‘denatures’ my DNA into bits of RNA.
No. This stage reads the viral RNA to produce a DNA compliment. Any human DNA from your nasal mucosa is not a part of the process. The technique specifically targets the viral genetic material
They may say that the denature process does not destroy individual RNA sequences, so prove it.
RNA is somewhat fragile when isolated but as it is already copied that is of no consequence.
SARS-CoV-2 is a virus, of dubious provenance and does NOT contain DNA!
correct. And?
So let us now apply the 30 steps to amplify and recombine that RNA into DNA with-out any additional substance, ie no target substance.
reverse transcriptase is used to create a DNA copy which is then amplifed.
This is of course an act of creation well beyond a laboratory process and requires sexual re-creation a process not available to a Virus so just what is the PCR test detecting?
This makes no sense. DNA and RNA act as templates for their replication. Polymerases recognise bases and create a complementary strand.
This is really for you https://www.youtube.com/watch?v=Y4p6jhFaru4
30
Gee Aye it is you who are WRONG WRONG AND WRONG again.
https://www.google.com/search?client=firefox-b-d&q=pcr+tests+for+cancer
“PCR is extensively used in analysing clinical specimens for the presence of infectious agents, including HIV, hepatitis, human papillomavirus (the causative agent of genital warts and cervical cancer), Epstein-Barr virus (glandular fever), malaria and anthrax.”
The PCR test for SARS-CoV-2 is essentially the same test with a different seed.
The denaturing step reduces Human DNA into RNA. How else can a PCR tests for other causes of disease in humans work, Cancer, infections and other nasty conditions. The Soup thus produced is seeded with the RNA partial string being tested for.
If you were right any single virus would produce a single result after as many iterations as could be done. The process does NOT create anything. It does a Mix and Match process of all those bits of RNA in the denatured Soup!
00
No. PCR does not have a denaturation step to reduce DNA to RNA.
I don’t understand anything else you’ve written there.
10
Wrong. it is the annealing process that is using the Polymeras to combine the complimentary bits of RNA in the soup into DNA and is repeated 30 to 40 times to obtain a measurable quantity.
00
No. Annealing is the process of two complimentary strands base pairing at a suitable temperature. Polymerase has nothing to do with annealing.
10
Wrong. it is the annealing process that is using the Polymerase to combine the complimentary bits of RNA in the soup into DNA and is repeated 30 to 40 times to obtain a measurable quantity.
00
I forgot this doozy
It therefore follows that the RNA after the denature process is a soup of RNA parts.
Ribonucleotides are covalently bound in a string (see video above). With lots of heating they will eventually break apart, DNA not so much. However (get this into your head) the viral RNA is converted to DNA early in the process.
Denaturation at about 94 or 96C in PCR refers to the pulling apart of hydrogen bonds that keep the double helix together so that
…AGGGAGGCTTA…(millions more)
…TCCCTCCGAAT…(millions more)
becomes
…AGGGAGGCTTA…(millions more) and …TCCCTCCGAAT…(millions more)
The covalent bonds holding the GACT’s stay intact but the hydrogen bonds allow the two strands to unzip.
when it cools back down usually below 60C they re-anneal back to this
…AGGGAGGCTTA…(millions more)
…TCCCTCCGAAT…(millions more)
https://www.youtube.com/watch?v=OblPqlOOgew
50
Absolute BS Gee Aye, the recombined DNA will NOT be complete HUMAN cells!
00
What are you talking about? What have human cells got to do with a method of detecting a virus?
20
mods… is it possible for you to save my sanity and help slithers by asking him to show evidence rather than just writing any old thing?
46
You could do a better job of setting him straight instead of asking for censorship.
“The first part of the process ‘denatures’ my DNA into bits of RNA.” – The method looks at segments of DNA which are in a helix structure that is denatured so that segments can be amplified. These segments aren’t RNA. COVID is a single strand RNA virus so it wouldn’t be denatured, although it would need to be removed from proteins and lipids forming the corona. The enzymes and technique for RNA would be very different to that used for DNA etc.
52
Gee Aye makes lots of noise but very little sense with NO links and cannot read the links that are provided, he/she knows it all from personal experience which is never imparted to us UN-initiated.
The PCR process quite definitely denatures the DNA in the sample, resulting in an RNA soup.
Nasal mucus consists of a mixture of human cells and perhaps a virus or two.
Go away Gee Aye you have become a troll.
22
Even when used for RNA, they make a soup of DNA.
I don’t want to argue with you because my knowledge is Wikipedia level, but pretty sure about what I’ve written.
00
Gee Aye put in a worthy effort to explain things about hte PCR test that you are not familiar with. He’s handicapped that it probably needs a full textbook chapter with colour diagrams.
But I understand what he’s trying to say and I’m wondering if I need to do some more basic explanation of the code of biology.
GeeAye didn’t have links apart from youtube. I think you are missing that the ACGT’s are the DNA code – the chemical initials of the four letters of the DNA / RNA system? All biology codes use the same letters — yeast, virus, human, plant, everything,.
It all makes much more sense if you understand that the line of code can be any long combo of AAAGGTTGGCCC etc. And it has it’s own back up sequence. Each line has a mirror image and the A’s always bind to T’s and G’s and C’s pair up. (And the letters are short for the name of the molecules EG C = Cytosine)
This automatic pairing means our code has an inverse mirror code, which acts as a back up copy for repairs.
Computers are binary, we are quaternary. Base 4.
PCR Effectively creates “back up” strands and then copies, in cycles to create many exact copies of short sections of code if they are present. The chemistry is extremely well known and finely honed.
40
Thanks Jo,
Can you do a post explaining the Reverse Transcriptase PCR test?
20
Hi Jo,
None of what you say is new to me.
Gee Aye has introduced miss-information many times.
Yes perhaps I could be more precise in my narratives like explaining that the resultant DNA produced in the PCR test is ALIEN and does not form complete strings of any actual DNA, it is Fragments of DNA that match the seeded RNA that was introduced to the specimen.
PCR is used to INDICATE the presence of many different RNA sequences in dozens of tests as well as the SARS-CoV-2 test.
It is ALWAYS used as an INDICATOR, never as a DIAGNOSIS as a stand alone test!
Yet people are being locked up because they tested positive.
20
The paragraphs below are from an article by Jon Rappoport:
“Here, from Canadian researcher David Crowe’s bombshell paper, FLAWS IN CORONAVIRUS PANDEMIC THEORY, is a key quote about the PCR test [5]:
“A review of 33 RT-PCR tests for COVID-19 approved under US FDA Emergency Use Authorizations showed a wide range of differences in what the tests were looking for and how they decided whether they had found it. The tests look for a variety of different segments (‘genes’) of the presumed COVID-19 genome, that only amounts to about 1% or less of the total genome, which is about 30,000 bases. Perhaps the worst feature of the tests is how they decide whether the sample is positive if more than one [‘gene’] segment is being looked for. Some tests look for only one, so it must be present for a positive. But tests that look for two segments are split between those that require both to be present and those that require either one for a positive. Some tests look for three segments but only require any two to be present, while one test insisted on all three. Tests that allow a segment to be undetected raise the question of how it can be said that a virus was detected when an important part of it was missing.”
If the PCR is a uniform standardized test, a rabbit is a spaceship.
Speaking of lack of uniformity in test results, here is a quote from Stephen Bustin, who is considered one of the foremost experts on PCR in the world. The excerpt is from his 2017 article, “Talking the talk, but not walking the walk: RT-qPCR as a paradigm for the lack of reproducibility in molecular research” [6]:
“Awareness of variability problems associated with PCR has been long-standing, with the first report describing inconsistencies with replicate and serial specimens evaluated within and between laboratories as early as 1992. The lack of a theoretical understanding of the dynamic processes involved in PCR, especially with respect to the amplification of nonreproducible and/or unexpected amplification products, was also highlighted decades ago. These observations and the resulting implications are largely disregarded.”
20
joseph. Have you heard of a DNA barcode?
Take a fragment of unknown animal tissue. Extract its DNA and amplify it with a particular PCR reaction. The targetted DNA is from a genetic region found in all Animalia which has variable parts (the primers used to target this region are from a highly conserved part.
Take the amplified DNA and sequence it (ie produce a length of ACGT’s). This sequence might be 800 nucleotides long.
You then compare this sequence with a data base containing millions of sequences and you can pinpoint the animal to species, sometimes subspecies and even population. At this point, if you want you can go back to the sample and get more genetic information using other PCR tests that might, for instance, allow you to check if the sample is from the same individual you caught last week.
The point of this is that you can identify and distinguish among millions of species using a few hundred letters in a sequence and this is from about say 1000/5 billion letters 0.0002%
In other words the proportion examined is irrelevant. The important thing is the integrity of the information.
30
Jo… finding out about PCR is as simple as googling PCR. Why should I be curating a list of links (and the youtubes were quite good btw) viz-
Slithers is writing absolute nonsense and making claims as a result for which he should have done the background reading BEFORE posting. To expect someone to then fully explain the method which he purports to understand is an unwarranted imposition. If I am failing to convey an understanding of what he should have known before writing how am I to blame for what he initially wrote?
20
and Jo… please tell slithers that DNA does not denature into RNA.
11
Gee Aye, I am grateful you are putting in the time to explain things, and largely agree with what you post on PCR and Covid.
I had assumed that people with an excellent grounding in physics or maths would have little trouble picking up biochemistry. But I have underestimated how much there is to learn or convey about biology and chemistry and how research in these areas has some fundamental differences even though it uses the same scientific method as the hard sciences.
Thank you. I appreciate your comments.
10
Hi Jo and Gee Aye.
The PCR test data as provided by the nature article does make serious effort to detect the presence of SARS-CoV-2 in the supplied sample.
The article from which the data pertaining to the SARS-CoV-2 nucleotides makes interesting reading.
https://rdcu.be/b7p1c
It states quite clearly that many of, if not all PCR tests currently in use are liable to produce false positives. The information about those RNA strings was published in LATE June 2020.
It is highly probable that most if not all PCR tests which do NOT use that newly published data will continue to produce False positives.
The article goes into considerable detail about how those examples were produced.
Everything I have posted here regarding the PCR test process is validated in many publications that pre-date SARS-CoV-2.
You want risk being forced to be inoculated because you tested positive to an un-reliable PCR test?
I rest my case!
20
Well you gave it a crack, thanks for commenting, we do read what you write. understanding it requires me to look up nearly every word.
10
MP… there really are a lot of good resources for understanding these things – pretty much a video or slide show for any aspect of molecular genetics. Just add “for beginners” or “basics” or similar to your searches.
10
Ok Gee Aye, we now know how you get your miss-information. YouTube and For Beginners.
The Denature process causes DNA to denature into RNA.
SARS-CCoV-2 consists of a long string of RNA, no need to turn it into RNA during the Denaturing part of the PCR test.
The denaturing process does change the nature of genetic material which is why the temperature during that process is so critical to a good outcome.
LOOK it UP!
Polymerases 1 & 3 do different things during the annealing process.
Look it up!
10
They turn the RNA into DNA, then do the PCR. I’m not joking.
00
The Denature process causes DNA to denature into RNA.
link please
Annealing requires no polymerase. If that is wrong show me a link.
Annealing (biology), in genetics, means for complementary sequences of single-stranded DNA or RNA to pair by hydrogen bonds to form a double-stranded polynucleotide.
10
https://www.iaea.org/newscenter/news/how-is-the-covid-19-virus-detected-using-real-time-rt-pcr
20
This is OLD data about Polymerase
https://www.google.com/search?client=firefox-b-d&q=what+is+polymerase+enzyme
This is yet more.
https://www.thermofisher.com/au/en/home/life-science/cloning/cloning-learning-center/invitrogen-school-of-molecular-biology/pcr-education/pcr-reagents-enzymes/dna-polymerase-characteristics.html
And this describes in considerable detail the PCR process.
https://www.yourgenome.org/facts/what-is-pcr-polymerase-chain-reaction
And this describes the difference between type 1 and 3 polymerese.
All these links are OLD. predating SARS-CoV-2.
And you really believe that NATURE would publish a data set that did not deliver the required result!!!!!!!
And where is the data that describes the RNA of SARS-CoV-2 and why was it only published AFTER the event along with the Bat virus that had been sequenced in 2013.
10
Table 1 in your example from Nature magazine is rather odd.
It refers to SARS-CoV-2 genes and gives -3 and -5 strings for comparison which is rather strange as the most noticeable and rare and published three neuclitieds ‘CGG’ are not part to the test set.
If it is rare and part of the SARS-CoV-2 RNA sequence why is it not part to the test sample?
20
Yeah done and doing, I appreciate your tolerance in this matter but this stuff is up there with rocket science.
I do come for your sarcasm though.
Slithers, I suspect he does this sort of thing for a living, I will listen to his view. He has been dealing with me respectfully for many many posts and does request links to your facts which is a fair call. His comment was directed at me as he knows I am thick, as do I.
10
Slithers,
If you take a swab, put it into a molecular machine like a PCR machine and you still find DNA remnants there, that doesn’t mean you have an intact virus, it just means you’ve found the sought after piece of DNA. That is the problem of PCR testing, it does NOT tell you that you have ‘the virus’, it can only at best tell you it has found a bit of what might probably be the virus (assuming that the PCR test is correctly testing for the unique part of a virus).
There are many unknowns in this area but to ask who and where has this virus been isolated is a very hard question with lots of misinformation. So has the researchers and medics got the ‘golden’ sample of virus somewhere? If there is please provide the information (who, where, when, links to research papers and citations — NO more opinion pieces, I’ve seen too many) because is has escape my efforts to find it!
60
From above I would like to see the pathway from local virus isolation, analysis of the local virus RNA structure, then the linkage to design of PCR test sample. I have found it nowhere.
Why the ‘local’ in that question(?) — because there appears to be more than one strain of COVID virus, thus the PCR derivative may have to be adjusted to the local variation.
~~~~~~~~~~~~~~~~~~~~~~
Also of note is this scientific look at the human microbiome.
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7043356/
How much of either our own human DNA or any of the microbes/viruses/germs/micropharges/ etc., could be carriers of that very small PCR target sequence? As researchers do not fully know or understand the variation of ‘other’ microbes that live within each of us, or the geographical variations that occur across the planet, it would be interesting to see how these are screened out.
I am also very curious as to how they can keep the number of false positive down to reasonable levels, given this potentially vast array of genetic material from any individual.
The nose, throat, sinuses, Eustachian tubes, trachea, larynx, and bronchial tubes, etc., are the very areas where enormous numbers of ‘foreign’ microbes tend to invade our body from, and where some of our most profound immunological battles take place.
70
It is instructive to research the very different suppliers of polymerase and how good they are at doing a ‘PCR’ Sars-CoV-2 test.
You basically get what you pay for!
20
I have a supply that I pay nothing for. A high expression plasmid in E.coli does the job. Research grade not for clinical or police work.
20
The PCR test process is used extensively to test for the presence of Substances in a sample of genetic material. The process uses a denaturing of the sample and the use of polymerase to amplify the presence of minute quantities of the substance being looked for.
PCR is extensively used in analyzing clinical specimens for the presence of infectious agents, including HIV, hepatitis, human papilloma virus (the causative agent of genital warts and cervical cancer), Epstein-Barr virus (glandular fever), malaria and anthrax.
In the case of papillomavirus the quantity of the resultant amplified DNA is an INDICATION or susceptibility, not a Diagnosis!
PCR is now testing for the presence of RNA string(s) purported to only exist in SARS-CoV-2.
The PCR test used to detect Covid-19 does this:-
The denaturing process is basically HEAT (94 C) in the presence of a reaction medium and the pseudo RNA that is being searched for, making a soup of bits of RNA strings.
The annealing process is a cooling and re-heating process and describes the method applied in many industries of changing the structure of substances.
During this annealing process cooling to (54 C) and heating (72 C) specific temperatures, many times(30-40), causes the amplification of any re-combined DNA, this uses polymerase to join together the bits of RNA and form DNA.
Polymerase is an enzyme that works much like the zip mecchanism you pull on when you uise a zip; the part that causes the two separate strips of teeth to mesh into a fastener.
The heating process stirs the soup just enough to mix it without breaking up any DNA present. The cooling process allows the polymerase to zip up any more bits of free RNA into bits of DNA. The theory relies upon the increased number of RNA bits as introduced to the sample with any and all matching bits that can combine to the sequence being searched for and make DNA.
Polymerase joins together the neuclitieds in the same sequence as is found in DNA. The denatured soup containing the sample and the searched for string of neuclitides pseudo RNA is zipped up by the polymerase into pseudo DNA.
PCR is now testing for the presence of RNA string(s) purported to only exist in SARS-CoV-2.
Please remember that SARS-CoV-2 is a virus so contains NO DNA, it consists of RNA.
The PCR test indicates the presence of Bits of DNA!
The repeated Annealing process ensures that as many as possible bits of RNA are re-combined.
This DNA comprising of the SARS-CoV-2 partial sequence with Bits from YOUR cells can then be counted. The Human DNA count will have gone down and if present the pseudo SARS-CoV-2 if present will have gone up and can be counted.
An INDICATION of the virus in the nasal sample can then be assessed.
Wether the test uses one, two or three, unique RNA sequences and the actual sequences are of course intelectual property of the company manufacturing the test kit and not for publication.
But if you test positive you can be locked up!
10
The audience will be pleased to know that I will not respond to this gish gallop. Suffice to say it contains the same fog of misunderstanding as previous comments.
31
GEE Aye, knows it all of course. The PCR tests takes the very few virus taken from your nasal cavity. AMPLIFIES them and by some miracle converts them to DNA which the PCR test can then count and declare the patient was infected with SARS-CoV-2.
In Gee Aye’s method. there is NO human DNA that is denatured so no resources to combine and amplify.
Where does the PCR test get the raw materials to do this magic amplification.
Lets say just 6 viruses in the original sample and 60,000 are needed to deliver a positive result.
That’s an awful lot of material from nowhere.
If the test can identify 6 viruses why bother with the time consuming Amplification process?
In my scenario, the sample of Human and Virus material is denatured, turned into a soup, several million bits of material. The Annealing process then uses the Polymerese to re-combine those bits into DNA. Not difficult and if the 6 viruses were amplified in this way then not difficult to get a detectable quantity of PSEUDO SARS-CoV-2 DNA. Initial 6, then 12, then 24, then 48, 96, 192,384, etc in a neat progressive way. 30 or 40 iterations to get to the detectable number (60000) that is needed for a positive result.
21
tomo… so far there have been millions of PCR tests so there have, with certainty, been false positives for a number of reasons – mainly contamination or method errors.
To date though nothing has been detected that suggests cross reaction. A matching sequence from another source would contain a sequence that falls outside of the range expected for a pandemically reproducing virus – all actual covid virus’s will be related to the original that started the outbreak. Any other virus or bit of DNA sitting in a human genome, will be divergent from the pandemic virus.
I’m not sure of the numbers but so far there have been 10’s of 1000’s of PCR identified samples that have gone on to be sequenced such as seen here and none hint at anything other than the pandemic virus
https://nextstrain.org/sars-cov-2/
20
Gee Aye,
You sound like a climate modeler, “we’ve looked at everything, and only what we say fits the bill, so it must be that.”
No I do not accept what you are saying for as far as I know NO PRC products have been tested for other microbes or other matter that could be confounding factors in the results. Why should they look, for like climate modelers they are convinced of their theory and their method.
I say again PCR is NOT good as the method was never designed as a diagnostic tool! History show that over-reliance can and did lead researchers and medics away from the truth of the situation. Read https://www.reliasmedia.com/articles/103405-cough-and-chaos-a-false-outbreak-of-pertussis?v=preview and follow up on the whys and wherefores.
Nature is far more imaginative than we can hope to be!
30
Hi Folks,
I have been reading the published report that accompanied Gee Aye’s table of SARS-CoV-2 PCR test data.
I clicked on the embedded link in the table so kindly provided by Gee Aye.
It is a well written article with much man in the street type information. I have a few issues with its generalization of some of the information, BUT:-
It makes very interesting reading, stating the obvious. many if not Most PCR test kits can and do produce false positives.
https://rdcu.be/b7p1c
The product produced by the writers of the article which was published in June 2020 is very probably not yet in widespread use.
Beware of PCR tests!
PCR is NOT a diagnostic, it is an Indicator at best!
30
correct. It detects the virus’s nucleotides. It is not PCR that decides what to do with that information, it is a person.
10
So we agree the PCR test just tells you what the designer wanted it to. That is to discover some nucleotides and nothing else. To say that only this virus can supply these fragments is (IMO) a stretch credulity to breaking point.
PCR DOES not and can not indicate you have an active version of this virus it can only indicate a probability, and given all the other variables it is quite low probability of having and active virus.
“I’m not sure of the numbers but so far there have been 10′s of 1000′s of PCR identified samples that have gone on to be sequenced such as seen here and none hint at anything other than the pandemic virus”
Or maybe not the virus but a consequence of something else. PCR hit rate is not good, it was never designed as a diagnostic tool. It’s not like there is not some history of over-reliance on PCR hasn’t flagged up a false ‘epidemic’ in the past because it has.
The reliance of PCR as a diagnostic technique for pertussis in 2006 led to an ‘epidemic’ which turned out to be false.
https://www.reliasmedia.com/articles/103405-cough-and-chaos-a-false-outbreak-of-pertussis?v=preview
My point is that PCR tests are not the best tests for this current situation, better tests are needed. Also there has not been a fully verified and validate tests to ensure what is reputed to be the ‘isolated’ COVID virus is so! There is NO ‘golden’ virus stock from which the PCR tests are derived.
30
why? When you design two primers with 20 base pairs you have a 1/4^40 possibility of hitting on those two by chance (* actually much less chance since they have to be also located near each other in the genome). This is the basis of every PCR reaction no matter what its application and there have been billions of them for 30 years.
The DNA data base obviously does not contain every genome of every virus but it has a lot. It also has thousand of humans. There is no match with anything other than nCOV. Further there have been a lot of known negatives tested (ie pre covid19 samples) that have never produced a positive PCR.
Agree about not detecting live virus. No one said it did.
30
Gee Aye
“When you design two primers with 20 base pairs you have a 1/4^40 possibility of hitting on those two by chance (* actually much less chance since they have to be also located near each other in the genome). This is the basis of every PCR reaction no matter what its application and there have been billions of them for 30 years.”
And that is why there are NO false positives (or negatives)
Let me Repeat because you don’t get it …
PCR hit rate is not good, it was never designed as a diagnostic tool!
What about do you NOT understand!!
30
Tomo… here is a fun thing to do.
1. Go here for a list of primers that are designed to target SARS-CoV-2 https://www.nature.com/articles/s12276-020-0452-7/tables/1
2. Copy one of the primers. For example this . This is a length of DNA that targets the virus in a PCR reaction.
3. Go to this web site. Blast has access to all DNA sequences of all sorts. Everyone sticks their DNA sequences there.
4. Click on the green Nucleotide blast button. Don’t panic.
5. Paste your primer sequence into the box labelled “Enter accession number(s), gi(s), or FASTA sequence(s)”. Your primer will be recognised (it is actually in FASTA format already.
6. Scroll down to the blue “BLAST” button and press it. All the other parameters can be excluded.
7.Wait a while – it does some weird screen refreshes and adjusts its search on the go,
8. You will have 100 hits which are all sars-cov-2. No surprise.
9. Go to the top “Filter results” window and paste in SARS-CoV-2 * and check the exclude button (ie you are searching the results for anything other than the virus)
10. View the results.
*step 9 can be done in the step 5-6 but it is nice to see some results rather than getting nothing.
20
For example this GTTGCGACTACGTGATGAGG
10
Step 3 – Go to this site https://blast.ncbi.nlm.nih.gov/Blast.cgi
10
Gee Aye September 18, 2020 at 1:25 pm
Yes all very virtual!
30
Gee Aye
Here’s a better ‘fun’ thing to do, it’s a real BLAST.
Read this https://www.reliasmedia.com/articles/103405-cough-and-chaos-a-false-outbreak-of-pertussis?v=preview
Then investigate what was wrong.
Then ask yourself is not the utter reliance on PCR tests just a set-up for the same kind of FAILURE!
Also you may be interested in https://royalsocietypublishing.org/doi/10.1098/rsos.200636
where they say …
So we’ll just keep using the same PCR test cos that bit doesn’t change eh?
Prove it, because I don’t think your ideas are very credible!
20
Also of interest was S. Korean researcher who looked at the 2 recent new outbreaks of COVID in Korea, that originated from people arriving back from abroad. They were able to identify two different regional COVID strains, and determine the approximate locations where these particular viruses types originated from.
And finally from https://medicalxpress.com/news/2020-08-tracks-evolution-sars-cov-virus-mutations.html
[my bold]
Fast mutations are, as animal studies have shown, quite normal with newly acquired viruses. They then usually slow the mutations as the viruses adapt to the host (or are so deadly that they kill all the hosts at a particular location, and ending their own existence).
That is why I feel sure it is necessary to check that the most prevalent virus strains at any location correctly fits the PCR test samples used now at that location.
In my estimation viruses tend to mutate to better fit the host, in doing so it usually happens that as viruses mutates to become either less deadly and more infectious, or the opposite.
Or maybe this COVID virus will be like the flu virus mutations, and it’ll settle into the most prevalent version having it’s infectivity/mortality chaotically change periodically (but eventually like flu within a set of reasonably well known variants). If this happens we’d have to be up to speed with checking the variations at many geographical locations and have proper diagnostic tests (not unreliable PCR) that are made for the particular virus variations.
40
Oh dear. German electricity imports hit new record, rise 43.3% in first half of 2020! How can this be in Renewableland?
https://notrickszone.com/2020/09/16/german-electricity-imports-hit-new-record-rise-43-3-percent-in-first-half-of-2020/
So build more bird-choppers . . . or maybe not . . .
New study shows offshore wind turbines may cannibalize each other when “improperly sited”. More “unexpected” costs and inefficiency to add to all the rest. And what of onshore wind turbines????
Who could have possibly imagined that an upwind turbine would steal the power of a downwind turbine? Not the German authorities apparently.
https://notrickszone.com/2020/09/15/new-study-shows-german-offshore-wind-turbines-may-cannibalize-each-other-if-improperly-sited/
100
Gemany was once a great Engineering country, its hard to beleive now.
Part of that item also pointed to record exports. It seems even though imports have risen, they do at times produce power they cannot use and have to dump it across borders.
20
Viewing for Victorians to marvel at in the link here
“Witness life in Stockholm these days. Notice anything different – – ”
http://www.smalldeadanimals.com/index.php/2020/09/17/september-17-2020-reader-tips/
40
And
“Freedom Slipping Away”
https://catallaxyfiles.com/2020/09/17/freedom-slipping-away/
30
This is no longer just about left versus right. It’s now becoming more about the establishment and big business versus the people. The only question is how rapidly does the situation deteriorate to the point where the silent majority no longer keep taking the BS.
40
Almost completely ignored by voters are United Nations interference and adverse impact on sovereignty, UN Agenda/Agreements such as Lima Protocol 1975, Agenda 21 now 30 circa 1990 and Kyoto then Paris Agreements, but many others all implemented by our elected governments using legislation and regulation with no referendum to ask the people if we agree but locking up our use of our land, natural resources, effectively abandoning most manufacturing industry and much more.
90
And as Victoria is showing us, the Sheepeople do what they are told regardless of hardship, mental damage, economic vandalism and then a minority thank the politicians for protecting them.
It’s that simple.
60
You know, I doubt it.
There is a scene in V for Vendetta”” where things change after the Brown Shirts murder a child and a mob tear one of the brown shirts apart.
If it gets so bad, they cant imprison or kill everyone……
Australians used to fix bayonets for jungle fighting, so I have no doubt the Australian mongrel gene will, if sufficiently riled up, deal with no matter who gets in the way.
Please dont get me wrong, I’m not advocating violence at all, I do know however there will come a point where people will lay down thier lives, just to drive the NWO globalists into the sea. I’d rather see it done peacefully, as they are set up to use violence to suppress people, but as Ghandi showed, you can beat a powerful enemy through persistance and peaceful means.
50
Yes but there were many lives lost one one side in the process. On April 13, 1919, hundreds of unarmed men, women and children were gunned down by British troops at Jallianwala Bagh. I doubt that it will be that “peaceful” in the West.
20
Victoriastan has managed uniquely to combine the Wu Flu death rate of Stockholm with the freedom of a gulag. And the Left think Daniel Andrews is doing a great job running Victoria as a police state with no judges, warrants or balance. I would not leave Daniel Andrews to mind children.
153
It seems herd immunity is not as hard to achieve as we have been told. Sweden, New York and other places are showing evidence of having reached that already but without a 60-70% infection rate.
The answer is in variolation, a technique used against small pox in the 19th century where the individual is given a low dose of the disease, not enough to make them sick but enough to prompt the development of antibodies. They think this is happening here. This has been presented as a reason to wear masks, thereby reducing the viral load of new infections and thus a large number of asymptotic cases. This would explain why there is a “second wave” of positive tests but an ever decreasing death rate.
Surely there is reason to relax restrictions. What we are doing is absurd.
80
Some are saying it’s illegal too. Time will tell if that’s true if and when it’s taken to the High Court.
10
There are 22 listed by the Northwest Coordination Center. 15 are listed as started September 7 or 8, with an unknown cause.https://gacc.nifc.gov/nwcc/information/fire_info.aspx
20
Interesting how all the liberal areas are burning……
Sydney and Canberra are 2 of the most liberal cities in Australia.
Israel Folau predicted the fires in Australia would bad due to the liberal policies adopted by Australia about SSM.
And now America?
Coincidence?
42
It’s a bit simpler causation to the correlation of riots petering out all of a sudden and about the time there is a large spike in fires lit in the area.
20
Precisely. Urban arson suddenly became unpopular with the Democrats when it was seen to be hurting their poll numbers, so their support for Antifa/BLM riots had to be curtailed. Arson in the surrounding countryside however is acceptable as it confirms the link to Global Warming, so the rabble swung into action burning the countryside where it will benefit the Dem’s Green New Deal push.
40
Its caused by climate change, which stops at the US Canada boarder because Canada did not pull out of the Paris agreement so the CO2 is lower in Canada.
40
The linked article provides a good analysis of the cost of FCAS and how it is levied:
https://www.energycouncil.com.au/analysis/reaching-new-heights-nem-system-costs/
In particular it looks at the loss of the Heywood interconnector for 2 weeks (I thought 4 weeks but there was another event in early March rather than 4 weeks total interconnector outage). The data is straight from AEMO’s Q1 report but with more discussion.
It concludes:
This really highlights how SA is getting a free ride on the backs of reliable generators in other states.
A new, less controversial name for weather dependent generators – just ‘variable generators. That avoids the fall advertising inherent in ‘renewable’.
50
Obama and Fauci were photographed together at the Wuhan lab in 2014, after the virus as it was then was transferred there after gain of function research was banned in the USA. It came originally from Fort Detrick labs. Plus a lab in Canada. The head of the Chinese military is reported to have addressed the CCP heirachy and said that conventional warfare could not be win but China would use biological warfare instead. The prime objective was to wipe out the ‘white race’ by 2030. It says this also in the UN Agenda 2030 document, hidden away after the 400th page. Fauci said last year publicly that America was going to get a very big shock (threatening trusting Trump) about February 2020, the previous year. It was featured by a number on YT.
Trumps weakness is that he is too trusting. A rotten apple will not become un rotten by being nice to it.
70
Reminds me of the awful NWO murals in Denver airport depicting biological warfare….similar theme…
Georgia guidestones?
10
Just grabbed a link with the story.
https://thesecrettruthabout.com/the-georgia-guidestones-mystery/
The story behind the DIA is as strange as the story for the guide stones, in the Murals can you see anything that appears to be happening now.
https://stillnessinthestorm.com/2020/03/something-is-rotten-in-the-denver-airport-25-photos/
00
In January 2017 Dr. Anthony Fauci, speaking at Georgetown University, said he had no doubt that the Trump administration would face a “surprise outbreak” of “infectious diseases.”
A few days earlier, The Atlantic published an article titled “How a Pandemic Might Play Out Under Trump,” which wished out loud that Trump’s handling of such an event would undermine his presidency.
https://americanmind.org/essays/the-covid-coup/
10
Trav, the US have a major viral outbreak every two years, (election years) so he is only stating the obvious.
Though I smell rats as well, the above covers his statement.
10
Here’s some info about solar installations on new apartment blocks which I believe are required by law in the dictatorship of The People’s Republik of Victoriastan.
I have a friend who purchased a new apartment in a block of twenty one two years ago. I was vaguely aware it had a solar parasitic load installed even though because of the building layout it’s not visible. I asked her to show me the electricity meter room where I found the inverter and its power meter.
I then looked at the common property meter and individual meters and could find no indication of power being fed into the grid even though solar was being produced at the time.
I then looked at her electricity bill and also found no reference to solar. I then asked her to call her electricity supplier.
The supplier told her that the original installer never registered the installation and therefore the apartment dwellers weren’t getting credits for the solar being produced. Furthermore, each individual apartment owner would have to have to pay $72 so they could get solar credits. The common property meter into which I assume the solar would flow was also not configured to receive solar input.
The outcome is:
1) That solar has been produced for two years and no one has been getting paid for it.
2) It is not clear what was happening to the solar that was being produced but it was definitely producing power according to the inverter power meter. Presumably it was flowing into the grid without the power company paying for it.
3) Is the original installer legally liable for the two years of lost feed-in credits for each property owner?
4) Who got all the taxpayer-funded subsidies that would have been applied to the original installation?
5) How many other new apartment blocks are in this situation?
132
was probably up to the body corporate to register the system rather than the installer, who should have provided the paperwork
10
The installer should have been able to register the system on behalf of the body corporate, but the body corporate would have had to sign the paperwork.
10
An interesting situation. Wondering if the common meter was a type that could be re-programmed to log exports. Surely there should only be one charge to export.
00
Some of the issues coming to the fore in the CV19 lockdown have resulted in new questions in the citizenship test targeted as certain faiths. Examples are:
These only address some of the cultural differences that make assimilating immigrants from certain cultures challenging. Australia must take care to assimilate new cultural groups to avoid these groups bringing the issues that inhibit development in their country into Australia. It takes at least two generations to get new cultures assimilated and become Australian. Trying to assimilate too many will change Australian culture; mostly for the worse.
111
Assimilation. through sport
Is it important to understand the different football codes?
13
Based on that criterion, I would be deported tomorrow.
Whereto I don’t know as I am a born and bred Aussie.
Perhaps the dark side of the moon; here in Geelong if you don’t follow a football team, particularly the Geelong Cats, you are persona non grata.
30
In Switzerland you cant get a Permit C (the closest thing to citizenship) without demonstrating language competence for the region you are in. You can never actually be a citizen, just an approved guest.
40
The people this new citizenship test targets will simply say yes, and then totally ignore it.
What’s better is to restrict immigration from countries that won’t assimilate and increase immigration from countries that will.
Hong Kong and the South African farmers come to mind.
50
Hello, I am new here, but I am interested in climate for quite some time now. Since I think it is closely tied to outdated hydrocarbons origin theory, I found a video describing different perspective, the core of russian hydritic earth theory.
It is worth time, and english subtitles works well:
https://www.youtube.com/watch?v=Rw3HmV4zO6E&feature=emb_logo
10
GW, I don’t have time to watch it myself, but I hope some knowledgeable person can help you, and if not this time, then feel free to try again. I know some people here are interested for sure…
10
Hello and thanks for response. I feel quite knowledgeable myself, just wanted to let you people know.
If somebody is more into scientific, you can check this:
https://www.pnas.org/content/99/17/10976.long
The hydritic earth theory as a whole has a huge implications and is changing view on staff such as
– how the ozone layer is being damaged
– how the earth’s magnetic field and heat are generated
– what is the impact on earth rotation, etc
00
Evening all,
I found this episode from Dr John Campbell particularly interesting for his discovery and comment about Dr Fauci. These are the notes I took, after I’d followed his reference to the Instagram interview of Dr F:
…
Dr John Campbell “Some Good News” 27 mins
At 18:41, Fauci is using vitamin D supplement!! !!!
https://www.youtube.com/watch?v=TZ7vPxWC-3Y
The Fauci reference, 37 mins:
https://instagram.com/p/CE7tWzinTI8/
and the words:
“If you are deficient in vitamin D, that does have an impact on your susceptibility to infection, so I would not mind recommending, and I do it myself, taking vitamin D supplement.”
That conversation starts at 31:37 in the Instagram interview.
There is no further discussion on it.
…
He was responding to the question “What can we do to boost our immune system?” (My shorthand version.) His initial answer was “No”!
Cheers
Dave B
40
This is scary… Facebook is now deleting C-19 related posts which are actually preprints of scientific papers submitted for peer review because their supposed “independent fact checkers” disagree with them. This came to my attention since I am a moderator of a group in which this was posted.
“Association of country-wide coronavirus mortality with demographics, testing, lockdowns, and public wearing of masks.” Update August 4, 2020.
Christopher T Leffler, Edsel B Ing, Joseph D. Lykins V, Matthew C. Hogan, Craig A. McKeown, Andrzej Grzybowski
https://www.medrxiv.org/content/10.1101/2020.05.22.20109231v5
41
Another test?
“I note in passing that we again have confirmation of the Facebook Inverse Truth Indicator: That Facebook banned crediting Antifa / BLM / DNC with the arson is confirmation that it is being done by Antifa / BLM / DNC followers… IMHO of course.”
https://chiefio.wordpress.com/2020/09/15/w-o-o-d-14-september-2020/#comment-132961
30
Not really…most social media appear to be rabidly anti-Trump and anti freedom of speech.
People should just dump thier social media accounts and look for alternatives.
60
Facebook says it’s cracking down on climate change misinformation. Scientists say it’s not doing enough.
“Climate change is real,” the company said. “The science is unambiguous and the need to act grows more urgent by the day.”
https://www.usatoday.com/story/tech/2020/09/15/facebook-climate-change-misinformation-disinformation-conspiracy-theories-wildfires/5799418002/
10
“tom0mason says:
17 September 2020 at 10:35 am
I note that the list of retracted and questionable research on COVID papers has now reached 33.
See https://retractionwatch.com/retracted-coronavirus-covid-19-papers/ for a list (with links) to these papers as well as ‘Temporarily retracted’ and ‘Expressions of concern’. ”
https://chiefio.wordpress.com/2020/09/15/w-o-o-d-14-september-2020/#comment-133001
10
Mater
#3588170, posted on September 17, 2020 at 4:33 pm
Anti-vaxx lunacy never sounded so good.
“It’s not anti-vax, you halfwit. It’s anti-concoction.
Speak to a variety of medical people, and you’ll be surprised how many of them are strongly pro-vaccination but will NOT be consenting to this particular one.
It’s basically politics in a syringe.”
https://catallaxyfiles.com/2020/09/17/freedom-slipping-away/#comment-3588170
91
Yep.
30
Of interst ( intersting how Alynski dedicated his book to Lucifer…)
https://townhall.com/columnists/walterewilliams/2020/09/16/the-devil-and-karl-marx-n2576177
“Paul Kengor is a professor of political science at Grove City College in Grove City, Pennsylvania. He has just published “The Devil and Karl Marx,” a careful look at the diabolical side of Karl Marx. The book has come out during an important time in our history since so many Americans, particularly our youth, have fallen for the seductive siren song of socialism taught to them by the academic elite.
And….
https://www.breitbart.com/politics/2020/06/24/black-lives-matter-founder-mentored-by-ex-domestic-terrorist-who-worked-with-bill-ayers/
“The co-founder of the Black Lives Matter (BLM) movement, Patrisse Cullors, was the protégé of a communist-supporting domestic terrorist for over a decade, spending years training in political organizing and absorbing the radical Marxist-Leninist ideology which shaped her worldview.
“Eric Mann, who mentored Cullors for over a decade in community organizing, was a member of radical-left militant groups: Students for a Democratic Society and the Weather Underground, which bombed government buildings and police stations in the 1960s and 1970s.
“In a newly resurfaced video from 2015, Black Lives Matter co-founder Patrisse Cullors reveals that she and her fellow BLM founders are “trained Marxists.”
30
By the way, it appears in the first article listed above, there are some pretty heavy duty views allegedly espoused by Marx toward certain groups of people.
10
Is Canada’s lockdown being pre-planned now?
https://www.armstrongeconomics.com/international-news/canada/canada-more-lockdowns/
Opening schools far too quickly and long before they are ready with new safety equipment, staff and new ventilation is a recipe for failure.
Add into this the Premier threatening to have the most expensive fines on the planet for any violations…
40
Its a misnomer to equate the number infections with death.
This is the game the MSM wants people to play. This is wrong. The death rate in Victoria at least has been a fairly consistent % regardless of number of onfections.
Ergo a “failure” in this case is failure of infection control, not actual control of medical damage to the population. Wile we need to protect yhe elderly, the rest of the population seem to dail through it.
The virus is now a pretty harmless, the lockdowns are about political power, bot illness. Exhibit “A” – the failed communist state of Victoria.
10
Death and injury to children has shot up nearly an order of magnitude in Victoria during lockdown.
00
Good news re Euro indifference to climate change
https://notalotofpeopleknowthat.wordpress.com/2020/09/17/research-reveals-climate-change-complacency-across-europe/
The EU leaders seem oblivious to this indifference. Even the alarmist author of the study says drastic action will not fly.
20
Tim Flannery: “If there was a moment of true emergency in the fight to preserve our climate, it is now”
https://wattsupwiththat.com/2020/09/16/tim-flannery-if-there-was-a-moment-of-true-emergency-in-the-fight-to-preserve-our-climate-it-is-now/
10
He’s still parked waiting for Labor to restore his sinecure in that resurrected Climate Thingamajig; at the risk of being thought cruel I admit to loving hearing him howl.
20
The Democrats are still saying Trump won because of Russian interference, and now they are claiming it’s going to be tried again. This smells like sedition on the part of the Dems.
https://www.washingtonpost.com/politics/harris-warns-of-russian-interference-in-november-election/2020/09/06/b4f0489a-f04a-11ea-b796-2dd09962649c_story.html
40
They are laying the groundwork to contest a Trump victory in Court. As with Bush/Gore it may be a while after the election before we know who the next pres is. Mail in ballots will be front and center, but other issues can arise. Litigation is like that.
50
Is it possible that fake mail-in ballots could overwhelm votes for Trump?
If so, this has to be the most worrying aspect of the election.
10
Sad to say those who remember Will Janoscka and wondered what happened. His daughter has just commented on Tuesdays thread to say he passed away in 2018.
That discussion is: here.
110
I thought I’d seen something about his death….RIP Will Janoschka.
40
Possibly it was a comment some time ago by Peter C.
00
Jo, are you watching this stuff from Australia on Twitter?
Form a US citizen, I think this is actually nuts!
https://twitter.com/justin_hart/status/1305572074514079744
Henry
00
I have never looked at a twitter link but you sucked me in and took my virginity, only to find its been everywhere. Rape charges pending.
To hold the protest in a market is pathetic as it takes sales from the vendor and does not help an otherwise worthy cause, they need to be careful they are not being set up by bad actors to lay the next wave blame on these protests and lose all public support.
I fully support protests for our rights, but it is a dish best served cold. (when we get some movement back)
Buy a yellow vest <$10 and write peaceful protest on it, wear it whenever you go outdoors and pass the message around whenever you can, post a photo on twatter and fakebook.
This will do two things, let people know they are not alone in their concerns and show the rulers we do not consent. Highly visual and when enough do this, will be very effective.
You don't have to agree with the protests, just be concerned about your rights.
One more thing to our Victorian brothers/sisters. You are not Victorians living in Australia, you are Australians living in Victoria, this goes for every other Australian. We are with you.
30
I don’t remember seeing this posted yet from Peter Ridd:
110
Note that PCR is just like computer code in the sense of it being “garbage in, garbage out”. It is important that you are analysing the desired samples and avoid cross contamination.
20
BBC TV Tax Subscribers Collapse by Quarter of a Million in One Year
https://www.breitbart.com/europe/2020/09/17/bbc-tv-tax-licences-collapse-quarter-million-one-year/
40
I remember Will Janoscka well from his contributions to this blog. He was always up for discussion on the contribution (or not) of radiative gases to Global Warming.
His avatar was a young deer caught in a spot light. And he had a cat.
Does anyone know where he actually lived?
Thanks to Mbenu for letting us know about his passing. RIP Will Janoscka.
60
I think he lived in the south east, forgotten the state, but he was a long way from Roy.
20
Uh-oh … It’s Tim Flannery … he’s back … and this time it really is the last chance …
2021 UN Climate Change conference last chance to avoid global collapse with “nine of the 15 known global tipping points [now] activated”
“The carbon dioxide molecule that accumulates imperceptibly as we burn fossil fuels causes an increase in average global temperature, which triggered the profoundly disruptive droughts, floods and fires that plagued Australia over the last year.”
https://www.theguardian.com/australia-news/2020/sep/17/the-megafires-and-pandemic-expose-the-lies-that-frustrate-action-on-climate-change
If the carbon dioxide molecule simultaneously causes profoundly disruptive droughts floods and fires, how do you know when it’s fixed?
30
Climate’s last chance – 2006
“The main indicator of how long we have to address climate change is the state of the Arctic icecap, which covers Earth’s northern ocean.
Before 2004, the rate of melt was such that scientists believed the icecap would melt entirely by about 2100. At the trajectory set by the new rate of melt, however, there will be no Arctic icecap in the next five to 15 years.
James Hanson, director of NASA’s Goddard Institute, is arguably the world authority on climate change. He predicts that we have just a decade to avert a 25-metre rise of the sea. Picture an eight-storey building by a beach, then imagine waves lapping its roof. That’s what a 25-metre rise in sea level looks like.
https://www.theage.com.au/national/climates-last-chance-20061028-ge3fvb.html
40
Re’ my comment about “climate DENIER” term. For years it has been used to describe those who are not convinced of global warming of which I am one. It began as a derogatory term the same as for those who DENIED the NAZI concentration camps where millions were killed in ww2. Over time those born in the last, say 30 years, have “generally” not been aware of the deed. To them it’s ancient history or seems exaggerated. Many sources do attest to that. It’s akin to the change attitude about skin colour of the 60s c.f. today’s reversal of Martin Luther King’s crusade. Thus, if the denial of the holocaust is gaining ground means less believe it than so too should those who use the term climate denier ought to be told not to say it since ‘denier’ has lost or is losing any significant meaning.
10
The Chinese shown the world (yet again) how bad the pharmaceutical industry is after a factory accidentally vented aerosolized Brucellosis bacteria to the atmosphere.
“Authorities have traced the leak back to the Zhongmu Lanzhou biological pharmaceutical factory, which was found to be using expired sanitizers and disinfectants. The factory accidentally vented an aerosolized version of Brucella, the bacteria that causes brucellosis, into the air last summer, causing it to spread across the surrounding area through the wind.”
“At least 3,245 people have contracted the disease in Lazhou, the capital of Gansu province, according to a statement from the city’s health commission. More than 1,000 are suspected to have the disease. No fatalities have been reported since the problem was first identified last November.”
From https://globalnews.ca/news/7341054/china-bacterial-disease-leak-pharma-brucellosis/
also see
https://en.wikipedia.org/wiki/Brucellosis
40
Article in this morning’s The Australian “Snowy 2 A Disaster in the making”. Signed by a lot of credentialled folks who look like they know what they are talking about. Unfortunately, article also says that batteries will work. But many interesting cost calculations, pointing out that the scheme will never pay for itself and Australian taxpayers will end up paying for another boondoggle.
50
What could possibly go wrong with the PCR test for SARS-CoV-2.
Well there is Polymerase and there is polymerase; several companies make it to various standards which contain Polymerases 1 and 3; which do different things during the PCR test process.
The ratios of each type therefore affect the outcome of the repetitive annealing process.
Then there is the source of and number of RNA bits that are used as the seed string(s) to be tested for.
This then raises the question as to the complexity of the RNA string to be tested for. The string ‘CGG’ is said to be rare It exists in SARS-CoV-2, it is easy to produce and use as the seed. How often does that string exist in the ‘Junk’ DNA that is part of the Human genetic code?
This then asks the question as to how many RNA bits are being looked for, one, two,three, or more?
This then raises the question of how many matches of these RNA fragments constitute a positive result.
Zero is obviously negative. How much and how many matches, one out of one, one out of two, two out of two, two out of three, etc all used by some person or process to indicate positive or negative.
Then there is the consistency of the seed(s) where did they get produced, how accurate are they, can we be sure that a short string of RNA is complete enough to be unique to SARS-CoV-2. What if the strings are not all of the same length for the specific RNA sequence? Can we be sure that such RNA strings cannot exist in any other virus?
False Positives are a personal disaster.
False Negatives are a collective disaster.
Here is how false negatives can be arrived at.
Poor application of the test swab.
The patient has known he is to be tested and washes his nasal passages with salt water just prior to being tested.
The patient had ingested the virus which is alive and well in his gut and will infect his lungs via his blood stream in a few hours time.
So What can we deduce from this.
The PCR test for SARS-CoV-2 should only be used as an indicator and further testing is needed to get a more accurate diagnosis before anyone is locked up or forcibly injected with a ‘Vaccine’.
10
https://www.hydro.com.au/clean-energy/hybrid-energy-solutions/success-stories/king-island has its diesel switched off and is using all of Wind, Solar, Battery, Resistor and Flywheel at the time of posting this. Highly amusing.
10
not really unusual, it should work OK for a small community but they will always be dependent on the diesel at various times. It would be interesting if they were to decommission and remove the diesel, but then there is reality.
impact on consumer costs would be interesting , if you could get through the haze of subsidies and grants. The savings on diesel would be significant howeve they have a lot of expensive toys there to maintain and replace
30
That’s interesting. The “Real Time Energy Dashboard” doesn’t have a time/date stamp so you don’t know what time the actual display is showing. It’s now 2037 EST and there is 15 kW showing from solar. Strong moonlight?
Also I’ve never seen a thorough cost analysis of the King Island system, including the cost of replacing the failed Flow batteries. It would be insightful to find out if the overall system cost plus maintenance has actually saved them any money over continuing to run on diesel.
20
Serp:
As far as I know the best example of wind reducing emissions was The Falkland Islands. There was a bureaucratic battle won by the engineers in the power station. They got control of the windfarm and ran it at less than optimum efficiency by manipulating the blade angles. By ‘throttling back’ the turbine the blades could be brought back to the best angle should the wind drop. Should the wind speed increase then the angle was adjusted to ‘spill’ excess wind. The result was a much more constant supply from wind, and it gave enough warning for diesels to be started or stopped.
The power station had 8 diesels of varying capacity so those in use could be adjusted to cover wind failures, or sudden increases, with a bit of warning. Bear in mind that the Falklands aren’t tropical and are notoriously windy. The result was a cut in diesel usage of 30% and they hoped to do better. They were also looking at the use of waste heat in the diesel exhausts to heat water and supply a neighbourhood warm water heating system for Stanley, but I lost contact and never heard how that went (tho’ I notice Shetland proposes to directly feed wind electricity into heating large tanks of water. This handles the variability of the turbines and hot water heating would work up there as required 12 months).
The scheme was so successful that it was extended to other Atlantic islands (Ascencion and somewhere in the W.I.)
A scheme on another island with wind turbines and pumped water storage wasn’t a success.
20
Frequency fluctuation is what engrossed my attention and I wondered how the lifetime of the Lion processing plant computer equipment was faring compared to the that in its mainland plants.
00
I think the Falkland system is better.
Even the Shetland method that smooths the contribution from wind without interfering with their diesel generators except in reducing the demand for electricity for heating.
And when I checked the King Island link diesel was supplying 60% — wonderful to have a reliable backup.
10
This is an actual photo of global warming, Greta is no longer the only person who can see CO2 with the naked eye.
https://qanon.pub/data/media/932b76d89ef10edda17e43c01263f1de5ce49147dc3922202014524f2c7d6d61.jpg
20
if I click on a qanon link, will the men in the black helicopters come for me?
asking for a friend
40
?? Got that link from a comment in a Brietbart article on the fires, I thought it was OK, does not appear to go anywhere but the picture.
The real question is about the company you keep.
10
Gas is supposedly part of the transition to fully fledged renewables, but now the green/left is pushing back and wants to scrap gas too. So when Morrison came out with his idea of supporting the proposed NSW renewable zones with Narrabri gas, there was uproar.
‘And what about Labor, a party of the left, allegedly committed to fighting climate change, the only one of the two major parties to have passed significant legislation to cut emissions? What did Labor do this week? Went along with it, more or less. There were some questions about whether the plan was much of a plan, but there was no strong disagreement. The truth is, Labor has pretty much given up on fighting on climate change from opposition.’ Kelly/SMH
10
Restrictions and a non-existent flu season bring decline in overall death rates in NSW.
‘Mortality data shows COVID-19 has not triggered a rise in fatalities unlike dozens of other countries that had less time to prepare or failed to curb the spread of the virus.’ SMH
00