JoNova
A science presenter, writer, speaker & former TV host; author of The Skeptic's Handbook (over 200,000 copies distributed & available in 15 languages).
Jo appreciates your support to help her keep doing what she does. This blog is funded by donations. Thanks!
Follow Jo's Tweets To report "lost" comments or defamatory and offensive remarks, email the moderators at: support.jonova AT proton.me
Statistics
Climate Scientists Admit Clouds are Still a Big Unknown
Admitting some cloud error is as close as most climate modellers come to admitting their projections are not fit for purpose.
https://wattsupwiththat.com/2020/09/12/climate-scientists-admit-clouds-are-still-a-big-unknown/
140
An Austrian analyst just might be moving towards the reasons why ‘climate models’ have it all so wrong.
and
So he reappraises the the whole CRE area and comes-up with some startling answers.
https://notrickszone.com/2020/09/11/austrian-analyst-things-with-greenhouse-effect-ghe-arent-adding-up-something-totally-wrong/
80
“An Austrian analyst just might be moving towards the reasons why ‘climate models’ have it all so wrong.”
So what do they have that’s right? Where is a single prediction which was proven right? Even the temperature has refused to climb!
And where is this strong correlation between CO2 and temperature?
We can even see the seasons in the CO2 graph but we cannot see any human effects or natural events including bushfires, volcanoes or even shutting the world’s airlines and most of the cars?
There is absolutely nothing right about these climate ‘models’. It’s not a model until its proven able to correctly predict the future, it’s speculation. And they have all failed. It’s been 32 years of getting every single thing wrong!
Models. No, they are completely wrong and it does not matter how ‘super’ your computer is.
60
And our own leading Science organization, the CSIRO, the huge company with 5,000 on the public payroll, the “problem solvers”, had 350 full time people trying to prove we had a problem. And failed. If anyone has a climate ‘model’, they should throw it out.
We should be building coal fired power stations as fast as China and attract manufacturing companies with the world’s cheapest electricity, as we did in the 1950s and 1960s. And put in UHVDC transmission lines. But I guess with few exceptions no one makes anything in public service cities like Canberra, Adelaide, Darwin or Hobart. And what a deterrent a fleet of antique Adelaide built diesel submarines will be in about 30 years. Peace in our time.
80
In our industry (farming) the CSIRO long held the position of Fairy Godmother. Many were the problems that the CSIRO solved for us. On top of that came the CSIRO’s achievements in the field of science for science’s sake. e.g. the Parkes radio telescope.
Then in December 1986 the Hawke government changed the management of the CSIRO, appointing a partisan board, with Neville Wran as chairman. Wran, national president of the ALP, was the first non scientist to hold that position. This was a bit before the establishment of the IPCC. And, I imagine, the CSIRO’s climate change department.
Then we saw the full front page tabloid headline: “Cows Australia’s biggest source of Greenhouse Gases.” A CSIRO scientist working in Tasmania had discovered this.
This was a monstrous lie. I knew it was a lie, but so little research had been done that it was impossible to prove that it was a lie.
I don’t believe that any self respecting scientist ever said it. This was the CSIRO’s now partisan publicity machine campaigning for the Marxist program for the abolition of private management of industry. Farming was the last sector of the economy still dominated by small business.. So convince the electorate that the farmers are villains in society, not to be trusted with the management of land.
That lie stood for years, and was taught in our schools and universities, until somebody did some proper research and discovered that farming, which includes “Cows”, is down the list of biggest emitters.
Note that this started nearly 34 years ago. 34 years on the Marxists in the Queensland and Victorian governments are working feverishly to complete their program of abolishing private management of industry by bankrupting small business.
80
Agreed, but you have put a date on it. Like all such bodies now, it is a political organization and achieves nothing itself. Science has been corrupted as it was in Stalin’s Russia. Even the WHO has been captured by a Marxist revolutionary under the direct control of President Xi. And their essential job, to stop pandemics, has been disabled. Is it a coincidence with the timing of Wuhan flu?
30
“So what do they have that’s right?” Dunno Tdef. I don’t think anybody does.
50
This comment to that article from Jeremy Poynton is also interesting:
130
RicDre
I’ve attempted to put another linked paper from NoTicksZone but its held in moderation.
Dated the 11th September 2020 and called ‘Austrian Analyst: Things With Greenhouse Effect (GHE) Aren’t Adding Up…”Something Totally Wrong”’.
It discusses the climate models and the assumptions made, then goes on to look at the CRE (Cloud Radiative Effect). The answers this Austrian analyst arrives at are quite surprising (for some).
[I freed it from moderation. I don’t know why it was captured.]ED
50
tom0mason:
Is this the paper you are trying to link to:
https://notrickszone.com/2020/09/11/austrian-analyst-things-with-greenhouse-effect-ghe-arent-adding-up-something-totally-wrong/
10
tom0mason:
My attempt to link to that paper also went into moderation.
20
Many thanks ED
00
Rick
Back a while on Chiefio’s blog.
At one stage of his career he was closing down a Cray and managed to make time available to a student who was modelling a cloud. Took the whole Cray
IIRC.
Doesn’t leave much room for the rest.
10
Apart from being an overpriced and overrated dinner option (IMnsHO), what is a Cray?
10
A bit of a calculator
https://en.wikipedia.org/wiki/Cray
40
The only accurate climate model to date is a Russian one that uses negative cloud feedback. All the others use positive and run hot. Even worse, the latest round of IPCC modeling (CMIP6) is running even hotter because the positive cloud feedback has been juiced up in something like half the 100 or so models. The models are getting worse, not better, wasting the billions spent on them over the last 30+ years.
Climate science is dominated by junk modeling.
420
Yes indeed David.
From http://eprints.whiterose.ac.uk/118549/
They’ve changed the TSI to an even lower value …
“A new and lower TSI value is recommended: the contemporary solar-cycle average is now 1361.0 W m‾². The slight negative trend in TSI over the three most recent solar cycles in the CMIP6 dataset leads to only a small global radiative forcing of −0.04 W m‾².”
The madness continues, Solar down and still the ‘climate models’ overcook the planet. Talk about living in clown cuckoo land!
[sarc-on]
Well thankfully we all know that the sun can’t possibly affect the climate as much as rising atmospheric CO2 levels. [sarc-off]
190
Dr Susan Solomon was crying into some blogs over a decade ago (it might be two decades ago!) about the models/modelling failure(s) to manage clouds.
I haven’t seen any further discussion since then (!) so I consigned any possible improvements over the years since to the ‘highly unlikely’ bin. (It could have been a strong tacit agreement that clouds were to be ignored.) That was when I wrote the models off as anything potentially accurate.
I note there is no need to change my opinion. CMIP 6 was supposed to fix that so maybe the `difficulty with clouds’ is really `difficulty with the modellers having difficulty with clouds.’
I had high hopes for CMIP6 but it seems not to be … just the same old same old.
80
I expect that statement would require considerably more definition of the word ‘accurate’ than is given in any dictionary.
What is meant by accurate and what is accurate. If the word is meant to imply that it is better at forecasting a meaningless number than other models can forecast a meaningless number then that could be true.
If you are implying the Russian climate models are a more accurate representation of the physics of climate then that could be true but it does not mean that the Russian model is in any way useful. The linked plot is for the atmospheric water vapour for 2017 to 2019 as predicted by the Russian INM-CM4 using the CIMP5 rc85 inputs:
http://climexp.knmi.nl/data/icmip5_pr_Amon_inmcm4_rcp85_0-360E_-90-90N_n_+++_2017:2019.png
Here the data is given as mass aloft over unit area.
This link gives the actual measured by satellites:
https://1drv.ms/b/s!Aq1iAj8Yo7jNg1uzA-KKFEvD5BzX
Here, the equivalent water column is given in mm (the blue trace)
The annual cycle is very clear in the actual data. This is a characteristic of the present orbital eccentricity, axis tilt and dominance of oceans in the Southern Hemisphere.
The fact that the output from the Russian model does not have this annual cycle means it is not a good representation of the physical world.
If you are happy with its ability to forecast a meaningless number to meet your test for accuracy then so be it. But it requires some definition of how you use the term.
30
prove it.
12
“prove it”
Yup you are right Gee, there are no accurate climate models. Sharp skeptical mind you have there.
40
fair comment. Why not join me in the crusade against unsupported absolutist suck holery.
20
CA & Feds take the first step — admitting the fire problem.
https://www.mercurynews.com/2020/08/23/california-fires-state-feds-agree-to-thin-millions-of-acres-of-forests/
Lots of clear statements about the mismanagement problem. Nothing on climate change unless the greens want to include the 12,000 lightning strikes that suddenly turned this fire season hot. (Of course they will, just wait for it.)
150
California fires. Further evidence renewable energy fails to prevent global warming on any scale …
“California is leading the nation toward a 100 percent clean energy future and addressing [global warming].”
https://www.energy.ca.gov/programs-and-topics/topics/renewable-energy
60
Sadly, CA Govenor has been on international News channels stating how clearly these fires demonstrate the effects of human induced Global Climate Change.
..and warns,… this is coming your way !
80
And we’ve never known a politician to waste a good crisis, have we???
What were you expecting? Humility? Honesty? Objective analysis? If he’d had those attributes, he wouldn’t be spouting the rubbish he already has.
Cheers,
Speedy
90
Reminds me of H L Mencken’s quote that politicians create a scare and then say that they are the only ones who know how to deal with it.
30
Part of the problem has been the arguing over MONEY! Now that was not expected was it? [sarc-off]
From https://www.sacbee.com/news/politics-government/capitol-alert/article232788192.html
Apparently California says there have been delays in payments for state Cal Fire and local local fire departments to ‘manage’ federally owned land. Is that the reason federal land hasn’t been clean-up, or is it that both California’s Green ordinances and Federal law make it too difficult?
50
It wasn’t clear from the article what percentage would be burnt each year. I believe that this needs to be around 10% every year to make inroads into the fuel loads.
70
David W – btw I remember seeing a NASA (I think) ‘bushfire’ map of Australia in (our) summer a few years ago showing thousands of spot fires in places in central AU that I knew hadn’t had any bushfires, and/or were desert and had nothing to burn. I checked the source and it turned out that the NASA data was based on nighttime images which IMO were mostly registering lightning strikes, not fires. Here in Brisbane we can easily get tens of thousands of lightning strikes on a stormy day. At least our BoM doesn’t appear to make the same mistake. PS I would not have expected NASA to make such a basic error, but these days anything seems possible!
50
rebirth of Russia , yep
https://balance10.blogspot.com/2020/09/rebirth-of-russia.html
21
postcard from Putin https://balance10.blogspot.com/2020/09/postcard-from-putin.html
01
Fentanyl worldwide https://balance10.blogspot.com/2020/09/fentanyl-worldwide.html
00
So … when can we expect “more severe and more often historic cold snaps” in a carbon (sic) induced warming world which is only getting warmer …
“3. Climate extremes – higher temperatures, more droughts, more severe hurricane damages, earlier and more serious wildfires, and historic cold snaps – are getting more severe and are occurring more often (October 2)”
https://yaleclimateconnections.org/2020/09/key-messages-about-climate-change-an-introduction-to-a-series/
30
What about during the hottest year … Evah …
2014 Set for Record Hot; Record Cold Thing of the Past
https://www.climatecentral.org/news/2014-set-for-record-hot-record-cold-thing-of-the-past-18360
60
ICYMI:
Anthony Fauci: Pandemics are Increasing Because We’ve Provoked Mother Nature
via WM Briggs: https://wmbriggs.com/post/32465/
60
Wait. What?
‘I believe in science’ Nancy Pelosi offered a rather anti-science explanation for the wildfires in California during an MSNBC appearance on Thursday.
“Mother earth is angry,” she said.
“She’s telling us, whether she’s telling us with hurricanes on the Gulf Coast, fires in the West, whatever it is … the climate crisis is real and has an impact.”
https://townhall.com/tipsheet/leahbarkoukis/2020/09/11/proscience-pelosi-blames-mother-earth-for-fires-n2576025
100
Travis:
When someone says they believe “The Science” you can be pretty sure they know nothing about science, unless phrenology and numerology have suddenly been declared science.
130
Maybe when somebody says ‘I believe in science’, they just left the word ‘fiction’ off the end.
190
[Duplicate]
20
Unbelievable. And what next? Vote Democrat or the gods will eat the moon? Or should we expect locusts, frogs and the death of our first-born?
For a country that was founded on the principles of the Enlightenment, the USA is pretty dumb. Or else she is working on that assumption.
Cheers,
Speedy
100
Quick!
Don’t just stand there!
Recall the Parker Solar Probe at once!
It’s annoying/irritating the Sun!
As anyone who follows RS (Real Science) knows, Hurricanes/typhoons/tropical-cyclones are formed by the Solar Wind.
So how can humans possibly annoy the sun?
Pelosi’s sanity is now in serious doubt: she should be gently retired into a locked padded cell and the key thrown away before she thinks to restart the Witch Hunts. Salem II just doesn’t bear thinking about …
60
If someone threw water on her, would she melt?
20
Dunno. Maybe she would just hiss even more.
10
and vent a lot of steam …
10
Everyone knows in the battle to control the solar system Mars and the Earth have been going at it for millions of years. If “Mother Earth” is angry, “Father Mars” must be elated. If I get to vote, I vote we appease Father Mars and let Mother Earth sink or swim on her own. But whatever we do, don’t rile Uncle Jupiter.
10
Travis T. Jones,
Part of the problem is the politicians and MSM shroud waving with the ‘confirmed cases’ numbers. This metric is all but useless for ordinary people indicating to most how and when more lockdowns are likely to happen. It does not tells you about COVID infection mortality. Sooner or later a majority of any nations population will have been infected, many with very few symptoms — even people in New Zealand will be infected — unless they isolate themselves from the rest of the world until the vaccine arrives (and exterminate all probable animal hosts).
No, the real important numbers that people should be concerned about (IMHO) is what percentage have died from the virus exclusively and with comorbidities. If that rises either the virus has mutated or the medical system is faulty, if it falls then medics are getting better at early identification and treatments.
Also (IMHO) it is about time that national agencies started collating statistic (and publishing them) about people with long term illness that are either directly caused by COVID, or have exacerbated known condition due to the COVID infection.
50
Latest on Tony Heller’s channel. He doesn’t actually comment on this one. Australia gets a mention.
“German Doctors Call COVID-19 Policy “Organized Crime””
https://youtu.be/BSyOUQEKzfk
2 min 20 sec
71
“LA County’s Public Health Director Accidentally Admits What Many Suspected About Lockdowns | Zero Hedge”
https://www.zerohedge.com/political/la-countys-public-health-director-accidentally-admits-what-many-suspected-about-lockdowns?utm_campaign=&utm_content=ZeroHedge%3A+The+Durden+Dispatch&utm_medium=email&utm_source=zh_newsletter
40
SNL – Translator is funny.
30
That’s what happens when people use bad modelling and base their decisions on them, as for example the Victorian government has done. It’s the same thing as what has happened with the climate change modelling where they have decided to reduce emissions. The only difference now is the politicians went one step further and implemented extended draconian locdowns.
100
A 30min video from the Computing Forever YouTube channel.
A look at C-19 statistics plus it looks at the question with another commentator is the standard PCR test specific to C-19 or does it detect all human coronaviruses? Ehat is the ultimate objective in various governments destroying economies and social structures with their C-19 “management” strategies.
Any critical comments on the video are welcome.
“It’s Time to Wake Up”.
https://youtu.be/Lh6VnB7JvW0
111
The question I have asked many times on this site and got crickets.
What is the PCR test testing for?
Good video, thanks for that.
90
Good question: I don’t know either so maybe someone who does know will put us both out of our misery.
From what little research I’ve put in: (all of a minute) so I’m way outside my comfort zone — miles, not metres — and not at all knowledgeable about this sort of chemistry Ergo my errors aren’t deliberate! But on the other hand, I love trying to figure out complex stuff for myself …
PCR = Polymerase Chain Reaction. Wikipedia alleged that it is used to make gazillions of copies of a specific piece of DNA. (I think.)
What little I know about viruses is that they are RNA (single chain) beasties rather than Double chain ( D = Di- in DNA) which made me scratch my head a bit. But maybe this explanation may help: (it’s my starting point):
https://gulfnews.com/world/how-covid-19-test-works-know-the-basics-1.1585053677091
I’m working my way through names and terms to try and figure it out … See how you get on and then we can both ask/scream loudly for help.
31
Thanks,
That was a good start.
10
RNA is converted to DNA via reverse transcriptase.
Primers are bits of DNA about 20 nucleotides long that are specific to a region of DNA – this can be checked against a data base of, now, trillions of DNA sequences.
The DNA polymerase amplifies DNA that the primers bind to. It is easy and quick to assess specificity and levels of false signals.
20
It detects nucleotides. How can you have not found that out for yourself MP?
14
Cause I was waiting for you to get back to work as I did look and could not understand the lingo.
What makes cov19 nucleotides different to other corona.
20
they differ by their nucleotide sequence order. Take these made up 20 base pair sequences (converted to DNA)from pretend closely related coronaviruses. I can design a PCr reaction that will detect one and not the other with a very high chance of detection and a very low chance of detecting the other by mistake.
GAAGGGACCTGGTTGATGTGATG
GAAGGGACCTGGTTGATGTGATA
This is text book and lab manual basics. People are doing this at home these days so the literature is out there pitched for you.
What is PCR for? There are dozens of uses but the ones of relevance to covid are:
-Detection of the presence of a RNA sequence specific to covid.
-making copies of the sequence so as to type it (see what the actual sequence is for epidemiological tracing)).
30
My Understanding of the PCR test is that it amplifies what RNA it finds. So some
GAAGGGACCTGGTTGATGTGATG and Some GAAGGGACCTGGTTGA, and some TTGATGTGATA get amplified and TOGETHER they get analysis.
This analysis then indicates the presence of those parts that you are looking for, sees the various bits and concludes that the whole sequence
GAAGGGACCTGGTTGATGTGATA was present and delivers a Positive result.
All it needs are sufficient bits of partial RNA to indicate the presence of whole bits that do NOT exist!.
Amplification does that. Keep amplifying and get different results!
00
your understanding is incorrect. It is target specific and will not- cannot- do what you suggest.
What is missing from your understanding is how DNA polymerase works. It can only proceed in one direction and it will only proceed from double stranded DNA (look up 5′ to 3′ – five prime to three prime – which is to do with the orientation of DNA. The DNA helix is antiparallel.)
The means that a primer like this 5’AACCTGGTTGATGTGATG3′ will only bind to its compliment and will only amplify if that 3′ (the right had) G is matched to a C on the target (oriented 3′ to 5′). Before you ask – it needs the other bases to bind as well to hold it in place and the PCR reaction uses a temperature profile to prevent mismatches.
If this is too much for you please find a year 12 text book and read up. I’m not going to regurgitate what is already out there for you to find and it would be good if you didn’t spread factually incorrect statements.
02
So The Virus which consists of RNA and NOT DNA can be recognized by parts of RNA that contain some nucleotide s
that resemble the DNA that is is targeted to see.
Who created that DNA?
What process is used to identify that DNA?
As the RNA sequence for SARS-CoV-2 is known, but no samples are know to be in existence, who or WHO you going to believe.
You seem to be ignoring the Author who created the PCR process who said specifically that the PCR test was NOT a diagnostic tool just an indicator.
You need lessons in reasoning!
20
Slithers ffs stop asking for spoon fed answers when you have clearly not tried to understand the topic. The answer to your question is reverse transcriptase which converts RNA to DNA.
The annoying thing about reverse transciptase is the it abbreviates to RT. This is confusing since RTPCR is also a PCR technique called real time PCR which detects changed in fluoresence from fluorphors bound to DNA when the DNA strands anneal and separate in real time. It is a method of rapid identification of primer annealing.
00
you might need to explain this with different words.
so what?
00
Gee Aye,
You seem to be ignoring the Author who created the PCR process who said specifically that the PCR test was NOT a diagnostic tool just an indicator.
so what?
Your arrogance astounds me.
The creator of PCR stated it was NOT a diagnostic test but an Indicator,
That’s What!
It is being used by Governments and Senior Medical people as a Diagnostic tool!
With absolutely NO REFERENCE as to the number of Amplifications used to arrive at the result they are looking for!
30
He didn’t create everything that went on after him. 30 years of technology that Mullis had no hand in. Please restrict your comments to informed rather than grab points youve read on the anti science blogs
11
Gee Aye,
If someone had come up with a more reliable tests than the current PCR they would be using it rather than a 30 year old version, Ok automated but still taking 12 to 24 hours to deliver results.
Where do they get the sample that they are testing for?
They cannot be using the complete sample from a known infected person as there are too many strains and would only get positives from a perfect match?
How can they be sure that what they are testing for cannot exist as bits and pieces of RNA after the denaturing process?
Soup making at 92 degrees C.
Why are there so many false positives being reported?
People have been forced into quarantine that do not test positive a few days later?
Were they Asymptomatic and are now cured?
There are too many unknowns and as the inventor of the PCR process declared. This is an indication of the presence of a sequence of nucleotide’s not a diagnostic of a disease!
20
The last time Slithers. This is so full of ignorance it is time to move on
If someone had come up with a more reliable tests than the current PCR they would be using it rather than a 30 year old version,
A. I hope so
Ok automated but still taking 12 to 24 hours to deliver results.
A. From Collection to lab, back to person that is about right.
Where do they get the sample that they are testing for?
A. up the nose
They cannot be using the complete sample from a known infected person as there are too many strains and would only get positives from a perfect match?
A. Usually one strain infects a person. The primers are designed for conserved regions and can have some redundancy.
How can they be sure that what they are testing for cannot exist as bits and pieces of RNA after the denaturing process?
A. Wrong. It stays intact.
Soup making at 92 degrees C.
A. ?
Why are there so many false positives being reported?
A. Already discussed and the reasons are many. As a fraction of the total the false positive rate is tiny.
People have been forced into quarantine that do not test positive a few days later?
A. So? There are reasons for this and you can berate someone else to spoon feed you the answer.
Were they Asymptomatic and are now cured?
A. PCR detect the nucleotide of the virus. You havn’t even understood this fundamanetal tenet. If the person is stops shedding the virus or does so at a very low level it might fail to be detected days after a positive. This says nothing about the disease.
There are too many unknowns and as the inventor of the PCR process declared. This is an indication of the presence of a sequence of nucleotide’s not a diagnostic of a disease!
A. Correct. As stated a million times by everyone; it is detecting the virus’s nucleotide sequence. Clinicians use this information to make a clinical call.
02
Probably time to move onto other Internet resources then
This one descibes the testing process https://www.imperial.nhs.uk/about-us/coronavirus-innovations/coronavirus-testing-explained
10
And Imperial College has such a great record of publishing great science, the link is to a dog and pony show of how Fake Science is promoted!
It purports to describe in very few words a process that requires some understanding of the various parts of the PCR process and how it can be used to identify the presence of specific nucleotide sequences.
10
I suspect people are starting to wake up but it’s a slow process, perhaps too slow. If it’s too slow the clueless and in some cases evil leaders we have among us will push things too far and lead to a very nasty ending. I do hope it does not end up that way but I’m afraid it will. Reality bites.
90
Hits the nail right on the head.
Explains the Club of Rome ABC interview where a MIT program is run on the CSIRO Computer modelling the great population reset to occur in 2020.
Fits nicely to the test results from University of Washington Virology Department where Corona Virus presents as about %5 of those with Flu like symptoms.
I’m awarding the 2020 Sheep Dog Award to the people behind this ‘Reset’ for herding a record number of sheep.
80
Whether by crook or by hook we do appear to be heading for the “Great Reset”. It’s really scary since it’s very close to being accomplished unless someone like Trump stops it. The problem is he is alone on this one. All other leaders, including our own state and federal leaders are following the hymn sheet of the Great Reset. I’m referring to the CAGW as well as the pandemic lockdown nonsense. In fact they are not even bothering to hide it any more: https://www.weforum.org/great-reset/
91
David, while not a video this article does help to put things into perspective regarding the political generated fear factor causing a breakdown of western civilisation just for the sake of doing so.
https://c2cjournal.ca/2020/09/rejecting-coronapsychosis-could-be-good-for-our-health/
30
“coronapsychosis” is a good description. OK in hindsight it does now appear that the “Non-lockdown Model” would have been the better approach. Now the West must admit they got it wrong and start getting back to normality ASAP with the usual precautionary measures spoken of many times here, not in months or even years as some are proposing, which would only lead to the complete destruction of Western civilisation. The state border closures really are now just purely political. I just wish someone would take it to the High Court to determine if they are actually illegal and unconstitutional.
40
Thank you, David.
Excellent video from Computing Forever with a very stark and clear message to us all. If our politicians were as stark and as clear as that would we be doing their bidding or telling them where to get off? We know that PCR testing is beset with issues. We know that data is being deliberately skewed. We know that masks are not the answer to lower transmission rates. We need to protect the vulnerable and allow the rest to live and let live. We need to stop being so gullible. We need to start fighting back.
40
Latest interview of Dr Zelenko by Dr Syed.
https://youtu.be/MhLD1P5nH30
101
Beat me to it David M,
It’s a great interview. 1hour 6 mins. I found it expanded on what I’ve seen before, particularly on the prophylaxis question, and on his early approach. But I was disappointed they didn’t mention vitamin D at all.
I’m also a bit surprised youtube hasn’t vetoed it.
Cheers
Dave B
70
Over an hour!
Thanks for warning me.
10
I’m sure his Trotskyist beliefs don’t influence his work at the BoM….
https://www.theunshackled.net/rundown/marxist-climate-scientist-standing-for-election-in-melbourne/
181
Hi David
I wonder what the response in the wider media would be if Andrew Charles was a confirmed Fascist?
Cheers,
Speedy
80
You mean Trots aren’t closet fascists?
Now there’s a turn up.
20
Strangely neither Donald Trump or Jo Biden have talked about those fires in the western states of the USA (its more than just one, but you would not know that from the news)
Could it be that the intelligence necessary to join the dots is missing from American politics, or are they really beholden to business, not their electorate, and certainly not to science, qv Covid-19, AGW, money printing (economics is a science)
326
It is not a federal election issue.
183
Well it should be, David. Trump made it an issue saying “we are going to have to do something about cleaning up the forests”. The fact is that the Federal Government owns 58% of Forest Land in California, ie the Federal Government is negligent in their management of that land, another Trump mega fail. Like PPE, they just don’t have enough rakes, and those trees you know “those trees just fall down and they become dry, dry like tinder and can catch fire”.
00
“Could it be that the intelligence necessary to join the dots is missing…”
It is more likely the intelligence to not connect unrelated dots that is present.
160
Perhaps PF could avail “American politics” of the “missing joined dots”, thus increasing the intelligence of everyone!
Here is some dots to begin with …
100
https://www.breitbart.com/news/dozens-still-missing-in-oregon-as-weather-helps-fire-fight/
You probably need to widen your horizon. Trump has made clear statements on the science of these fires and Biden is seeing smoke while attempting to read his teleprompter.
170
The dots you imagine or hallucinate are somehow connected to CO2? Naw. Climate change might* be happening but “we” are not causing it.
For example: The fires in California are not the result of climate change. They are entirely the result of forest mismanagement or quite possibly management with the intent of forcing a problem that can then be turned into a false narrative (propaganda). That, if true would be criminal but not at all beyond what the Left is willing to do TO their fellow man. You need proof of that?
*At some point in the future, we may possess the technology to actually measure what you claim is happening. Right now you are a babe in the woods fantasizing, dreaming, stoned or whatever.
160
Video:
“Is Antifa Starting The Wildfires?”
https://youtu.be/kX9DGP7HvPQ
111
“Arson Arrests Being Made Across the West Coast – Multiple Fires Identified as Arson – 27 People Killed, Dozens Missing….”
https://theconservativetreehouse.com/2020/09/12/arson-arrests-being-made-across-the-west-coast-multiple-fires-identified-as-arson-27-people-killed-dozens-missing/
120
Did they turn the water off to the towns/cities this time, as they did in the Paradise fires last year?
110
The NSW bush fire inquiry July31 this year begs to differ. Although, they seem to have down played the 63 offenses with only 11 deliberately lit to cause a bushfire.
11 can be huge and destructive fires (a small village was destroyed by one) but also, it’s hard to ping someone and prove intent. They downplay this by saying that they are only responsible for only a small percentage of the area burnt. They neglect to mention extremely large areas of grassland in outback NSW are started by lightening every year. What would be more informative is what portion of area burnt east of the dividing were lit by humans.
160
[Duplicate]
01
The severity of fires in the US is increased for the same reason as Australian fires are now more severe than they used to be.
Leftists prohibit proper fire management practices such as low intensity control burns at times of low risk to reduce fuel build-up.
281
There was an interesting comment buried in the comments on a Powerline Blog story about the California bushfires. The author said they worked for a forestry heavy machine business and that they were sold out for the next 6 months, and it looked like West Coast authorities are finally taking power line clearing seriously.
140
‘ … intelligence necessary to join the dots is missing …’
You mean the authorities don’t know the Californian wildfires have been caused by a blocking high pressure?
70
A) what is causing the blocking high, and if it is the quiet sun – do your have previous examples (hindcasting) of your model.
B) of the 4 topics I mentioned – Fires, Covid-19, AGW, money printing (economics is a science) they all have a common denominator which is none of them matter to the rich, well apart from the money printing which does matter to the rich as they are getting richer.
C) all of these 4 have been predicted, and yet nothing was done to prepare
212
‘…do your have previous examples (hindcasting) of your model.’
Nah, its a PhD effort.
Printing monies is good strategy in a deflationary spiral and coincidently poverty was eliminated in Australia during this pandemic, for the first time in our history. The rich may have become a little poorer, but there is no evidence to support the suggestion.
It is undeniable that Blocking Highs in Australia and the US exacerbated the fire seasons, this didn’t originate with increasing CO2, but because of a meandering jet stream,
If warmer temperatures were responsible for more severe bushfire seasons, then we should see the fingerprint during the MWP, RWP and Holocene climate max.
42
Rich inequality – use that as your search terms. Be surprised
What caused the meandering jet stream?
MWP, RWP, Holocene climate max – again where is your evidence?
Nah, its a PhD effort. – so all you really have is assertions and deflections.
27
‘What caused the meandering jet stream?’
We discussed this a few days ago, a quiet sun shrinks our atmosphere from the stratosphere, which is why they have to adjust the satellites. The zonal jet flows are altered and it meanders.
‘MWP, RWP, Holocene climate max – again where is your evidence?’
You are the one needing evidence to prove warmer temperatures automatically cause wildfires.
‘Rich inequality … ‘
That is how the system operates, rewards the free enterprise spirit and risk taking, which is essential if we are to progress. The utopian socialists party (USP) want to eliminate poverty and the filthy rich, leaving us with an upper and lower middle class.
50
Assertions don’t cut the mustard el gordo – I accept the view form the climate physics research which AGW is behind all this. Yes a lightning struck could cause a fire. Have the number of such events increased year on year? Is drought longer, more severe? Sure there are weather patterns, but they are a symptom
113
‘Have the number of such events increased year on year?’ No.
‘Is drought longer, more severe?’ No
This modern climate optimum may have reached its ‘used by’ date, the jury is still out, but its fair to say the current weather patterns are symptomatic of global cooling.
50
19 of warmest years in the last 20, game to me
112
Remember the Black Saturday Bushfires in 2009?
https://solen.info/solar/images/cycle24.png
I’ll slowly go through the solar variability charts and find correlation between bushfires and a quiet sun.
40
From nasa Set to me
112
Meandering jets streams and blocking highs Not a thing Match to me
211
I agree there is no impending mini ice age, but a return to the 1950s and 60s is on the cards.
The bushfires of 1996-97 were widespread.
https://www.solen.info/solar/images/cycles23_24.pngI
40
This might work.
http://www.solen.info/solar/solcycle_old.html
The Carbon Brief article doesn’t mention solar minimum, but this caught my eye.
‘For example, blocking events were behind the record hot, dry weather that saw devastating bushfires during Australia’s 2019-20 summer …’
20
’19 of warmest years in the last 20, game to me’
A small fraction of a degree is not climate change, you really need to study more paleoclimate history and soak up the ambience, otherwise you won’t be graduating.
50
“‘What caused the meandering jet stream?’”
In the 1970’s, The Polar Vortex Was Caused By Global Cooling.
https://notalotofpeopleknowthat.wordpress.com/2014/04/18/in-the-1970s-the-polar-vortex-was-caused-by-global-cooling/
2014: Blame the Jet Stream for Frigid Winters in Eastern U.S.
Cold back East and warmth out West is a jet stream pattern that has been in place for 4,000 years, according to new research
40
Fitz,
Thank you for your insightful reporting.
Here is another version:
https://www.cbsnews.com/news/trump-to-visit-california-to-receive-briefing-on-wildfires/
“Mr. Trump approved a Presidential Major Disaster Declaration for California in August. According to Deere, the administration has also approved 10 fire management assistance grants and 24 grants for other western states affected by the fires, providing a 75% federal cost share. More than 26,000 federal personnel and 230 helicopters have been deployed to the region to fight these fires.“
120
John F.: Here is another version:
Never let facts get in the way of a good story…
50
It is much easier to get money for fire management than for forest management. Politicians are aware of it. They get popular for fighting fires, not for preventing them.
40
Interestingly fire fighting helicopters in Oregon were sent to Afghanistan and are therefore unavailable to help fight fires. Why, because no politician could have predicted the fires as they do not believe in AGW
As to your CBS report – I missed that, but you know, it was drowned out by his other insights like black clad Antifa using their frequent flyer miles, or The ‘1917’ pandemic and World War II, or Trump suggests supporters should try to vote twice.
you know I probably thought that the federal relief efforts (and for california only), were of the same authority, after all they came out of the same mouth.
316
Peter F: Interestingly fire fighting helicopters in Oregon were sent to Afghanistan and are therefore unavailable to help fight fires. Why, because no politician could have predicted the fires as they do not believe in AGW
I am interested in the truth. Google provides one avenue of discovering it.
State military ordinance – CH-47 Chinook helicopters – being sent to Afghanistan would be a state decision. I don’t know if it’s strictly military or political, but it would have little to do with Trump. Do you have any evidence Trump was involved at all?
CH-47 Chinook helicopters can operate as firefighting helicopters, but they are general function helicopters.
Oregon is a very blue state. A quick google shows numerous videos / tweets of the Democrat leaders of Oregon proclaiming “climate chaos” and “climate change is an urgent threat”.
Not only do the Democrat leaders of Oregon believe in AGW, they either allowed or were actively involved in sending their military helicopters to Afghanistan.
My hypothesis is you have a burning hatred for some politicians and everything you read and then post is filtered through that hatred, rather than seeking any evidence of truth.
140
now there, sit down, Deep Breaths. I said “no politician could have predicted the fires” that is because all US politicians, and I’m going from C Span here – are, at best, bad ham actors, but undoubtedly are the thickest group I’ve ever seen standing on their hind legs. This is the US – you know the place with 3% of the world’s population and a quarter of the deaths (covid), a place where corporations are legally persons, a place with 14.3 million American households are food insecure, a place where the head of Amazon makes more in 10 seconds than most Americans make in a year. That place.
Are you trying to say that the president did not provide those quotes? Then who did?
Also notice that I did not have to resort to ad homs, and I would appreciate the same courtesy from you
111
Just saying Peter
There are NOT 14.3 Million households in food insecurity!
There is only 8.53 Million out of 128.6 million total at the beginning of 2020!
Down 0.908 Million since January 2017!
70
Peter has a problem with numbers Dave !
60
https://www.ers.usda.gov/topics/food-nutrition-assistance/food-security-in-the-us/key-statistics-graphics.aspx
my shorts – eat them
48
It’s 2020 Peter!
And the previous figure was 2017!
Put your shorts back on!
80
The link?
27
No link no prize – eg 50% of households are in food insecurity. Shorts do you want condiments with that
47
Peter….damn…what is chewing on your rear end?
40
Peter dear, the “food insecurity” is not the same in the USA and in Bangladesh. Likewise, “the deaths (covid)” probably mean something else in the USA than elsewhere. Possible reason: Many deaths make Trump look bad.
40
“14.3 million American households are food insecure.”
I could not find this figure in the USADA statistics you linked to.
Perhaps from a later publication.
A magazine article?
40
A video from New Zealander Dr Sam Bailey.
“Why are Covid-19 Cases Soaring in NZ? PCR Test Update.”
8 mins
https://youtu.be/kcONxyAJ8S4
81
“tom0mason says:
12 September 2020 at 6:29 pm
@H.R. says:11 September 2020 at 10:13 am
Capers, canned are high in Quercitin 180.77 mg/100g
They are one of the best plant sources high in flavonoid compounds rutin and quercetin. Capers contain various beneficial minerals, vitamins, and antioxidants that work to make the immune system healthy and strong.
These are one of my favorite indulgences, they’re great tasting and go well with other strong flavored meats such as lamb or goat. Also tasty in a simple caper & herb butter sauce with pasta, or in tartar sauce with fish, or as a snack with salami on rye. I like to eat the larger caper berries instead of olives.
More high Quercitin foods are listed here … https://healthguidenet.com/foods/foods-high-in-quercetin/ .
And yes I too am a great fan of both green tea and tonic water (6-10 liters a week).
”
https://chiefio.wordpress.com/2020/09/11/wuhan-covid-how-folks-prep-to-prevent/#comment-132851
100
Thank-you Another Ian 🙂
40
Just to give you a heads-up, Another Ian:
If you consume 10 litres/week of Schweppes Tonic Water you are consuming around 860 grams (that’s nearly a kilo) of sugar. That’s more sugar than if you consumed the equivalent volume of Coca-Cola.
That’s about 45 kilo of sugar per year.
Had your Insulin checked lately?
https://coach.nine.com.au/diet/soft-drink-sugar-content/13c3270b-f656-49d4-ad46-1d4223c3fe08#5
30
they do make diet tonic water
10
Let me just add to the heap of conjecture, the maybe’s, might’s, may’s could’ve etc etc….
https://www.spectator.com.au/2020/09/ashamed-to-be-australian/
70
Whilst I am not ashamed to be Australian, I otherwise fully agree.
10
James Allan is strong in his belief that the lockdown has caused more harm than the virus ever could.
The Australian government knew early that the virus was manufactured in the Wuhan lab, as a weapon of mass destruction. Its premature escape is a huge embarrassment for Beijing and credit to Morrison for acting decisively.
Because of the unprecedented nature of the pandemic, mistakes were made.
‘A security guard who shared a house with an aged care worker has been identified as the first formal link made between Victoria’s calamitous hotel quarantine program and the spread of coronavirus to an aged care home.’ SMH
So I’m not embarrassed to be Australian, we have a disciplined political culture, head and shoulders above our mother country and US cousin.
14
Ive seen comments from virologists who have said this thing is a *chimera* and therefore next to impossible to build a vaccine for. Also jibes with the original comments about the virus possibly having bits of h i v in it. Ive always maintained it was dodgy.
The whole thing though is just the excuse for whats happening in victoria.
Sometimes people just need to look at whats in front of them and believe thier eyes, not the MSM drivel. Kind of like how buildings collapse without being hit by anything…
70
I read similar comments from virologists when I first read up on SARS-CoV-2.
My daughter had returned from Northern Italy, via Spain. Both of which had outbreaks.
She self-isolated in the back bedroom, amazed that the UK had no compulsory quarantine.
(We sprayed, wiped and washed the landing and bathroom as never before. ☺ )
40
MalEx444 , disciplined?
Acting in who’s best interests?
Certainly not the Australian taxpayers.
10
That new-fangled news spread –
“May-Might”
30
Don’t be shy.
If only regular troll: Peter Fitzroy could get his head around the concept of “shame”…..
41
Technically speaking, Fitz is not a troll.
31
El Gordo says:
Technically speaking you are full of loose cra-p: https://en.wikipedia.org/wiki/Internet_troll
Fitz wobbles very carefully in and out of disruption and purposely distracts from the topic at hand.
I only comment here very infrequently now but I’ve been a regular for more than 10 years. In that time I’ve seen maybe 50 notable, regular and very good commentators disappear. Probably worn weary by the likes of Fitz and since you apparently support him maybe you too.
Sad really.
71
On this blog Fitz is a contrarian and I don’t accept his green/left point of view, but defend his right to speak. He is totally unnumbered and harmless.
72
el gordo: “On this blog Fitz is a contrarian and I don’t accept his green/left point of view, but defend his right to speak.”
I agree.
80
Another ridiculous comment.
It was, is and always will be a blog clogger.
Nothing “harmless” about that.
In the early posts it made, I read all of them.
Never, never was there anything said, no argument put, just a mass of verbiage.
Obviously Jo didn’t read them so was unaware of what was happening.
This has nothing to do with “freedom of speech” and everything about interrupting the blog and making it look stupid for tolerating an obvious insult.
KK
21
Fitz is up for a fight, he is an intellectual lightweight, but you have nothing to counter.
31
‘ … making it look stupid for tolerating an obvious insult.’
Lift your game, say something witty and profound.
I see Fitz as a school teacher who knows the mantra and we are a class of naughty boys in revolt against AGW theory. Nevertheless, being a good student, I gain much from the discussion.
Fitz put up the Carbon Brief article which confirmed that ‘blocking’ exacerbated the 2019-20 bushfire season. He is a bit of a task master, got me looking for solar correlations to back up my argument.
41
For the most part having Fitz around as an ideologue for the CAGW cause has been helpful for me to learn more about the subject .
Virtually every post he makes claiming whatever from his greenie hymn sheet is picked apart with the science of how ridiculous his claims are .
I’m sure I wouldn’t be alone in being the beneficiary of these encounters just by the amount of knowledge gained as to how ridiculous the claims of the CAGW crowd really are .
Having said that he does appear to have wandered a lot more to the left these days with his white privileged comments .
Either way I can pick and choose which of his replies to comment on or not comment at all .
71
And China took over Tibet to free them from religious persecution.
Or was it to “access” Tibet’s natural resources, trees, and make a packet for some lucky local Chinese official.
50
Rare Earth?
China took back Tibet in 1950 for geo-strategic reasons, it was the cold war.
https://en.wikipedia.org/wiki/Tibet_(1912–1951)
20
And the forty-six percent of the world’s population served by rivers originating in Tibet.
CCP’s management of asian rivers with dams provides a set of WMDs around the drought and flood axis under the guise of providing hydro power and flood mitigation.
20
Cold Water War
https://www.deccanherald.com/opinion/main-article/chinas-lust-for-water-860463.html
20
DOES the standard PCR test detect SARS-CoV-2 or just coronaviruses in general such as one of those responsible for the common cold?
https://youtu.be/gGavpYNpEP8
Comments please.
16 mins.
40
Hmm. Didn’t watch the last half as it seemed to be moving away from the critical question: Does the PCR test correctly isolate COVID-19 from other Coronavirus. I don’t know and would like to understand more about this.
20
Slectivity of the PCR testing regime operating in Australia is good. The evaluation of selectivity and level of detection are detailed here:
https://www.health.gov.au/sites/default/files/documents/2020/06/post-market-validation-of-the-beijing-genomics-institute-bgi-sars-cov-2-real-time-pcr-platform.pdf
The linked paper discusses Covid19 RNA more specifically and the extraction:
https://www.cell.com/matter/pdfExtended/S2590-2385(20)30305-2
10
It is specific to the virus causing covid 19. It is possible that an unknown virus might share the sequence.
Every single time that positive PCR tests are cross checked (now in the 100s of 1000s) by sequencing the whole virus in a person, it confirms it to be Sars-cov-2. In 100% of instances where a person is presumed to be infected by another person the virus check out as the same strain*
strain is misleading as most if not all mutations are unlikely to change characteristics of the virus.
10
WUWT recently had a post regarding Jane Fonda’s quote:
This was rather timely because I had just put a reply on Skeptical Science to their (very old) post addressing the question: “Does breathing contribute to CO2 buildup in the atmosphere?” Obvious Skeptical Science said no. Their argument was based entirely on the inviolate nature of the Carbon Cycle and completely ignored the effect of population changes. But it turns out that human population growth is important and could have increased CO2 levels by 30 ppm. See here.
So its seems Jane is right. Humans can increase CO2 levels just by breathing. I doubt you will find that in an IPCC report though.
30
Slarty: Humans can increase CO2 levels just by breathing.
I was curious about this same thing too, so I developed a spreadsheet to calculate the impact of humans breathing, some time around July last year.
My quick napkin-level-accuracy calculations show CO2 @ to be 305ppm in 2001 and 311ppm in 2019, based on human respiration alone.
I’ll have to have a read of the argument as to why respiration CO2 is already accounted for.
20
My reasoning was all CO2 inputs need to be accounted for. Human exhalations are just one more input for a “model” that tracks all atmospheric data.
10
You’re forgetting that well known modelling dictum –
“If in doubt leave it out”
40
Another Ian,
Surely it’s “If in doubt, adjust, homogenise, average, and statistically manipulate until it fits!”
70
Another Ian: “If in doubt leave it out”
There’s no doubt humans exhale CO2 – so why would there be any doubt that it’s a CO2 input for the atmosphere? If you were just being funny I missed it – but would welcome you expanding your point otherwise. Cheers.
20
Tony Heller revealed Hanoi Jane’s other great statement in a recent interview.
https://www.youtube.com/watch?v=juL7sJQJGCs
Jane Fonda: “I’ve been a climate scientist for decades and decades.”
60
Reposting from the Thursday unthreaded , as I put it on quite late in that thread.
I do not know anything about this Perth based researcher but reading the summary of her report, she seems to have dug very deep into the Covid issue from all angles. The report is long, but it might be worth a read.
https://www.harrisonpublications.org/covid-19-plandemic-profit-fallout.html
80
COVID any many other issues, thanks for the heads up.
10
sars-cov-2 update
9-12 Mexico 4.9/118.5= 4.1% increase/day new cases/active cases https://www.worldometers.info/coronavirus/country/mexico/
India 97.6/860.6= 11.3% increase.day https://www.worldometers.info/coronavirus/country/india
Indonesia 3.7/48.5= 7.6% increase/day https://www.worldometers.info/coronavirus/country/Indonesia
France 9.4/224.4= 4.2% increase/day https://www.worldometers.info/coronavirus/country/france
Brazil 44/570= 7.7% increase/day https://www.worldometers.info/coronavirus/country/brazil
Argentina 11.5/113.5= 10.1% increase/day https://www.worldometers.info/coronavirus/country/Argentina
………………………………………………..
8-6-20 According to Dr.Yan Li-Meng, an examination of the genome sequences released by the Chinese government on Jan. 14 also shows that Zhoushan ZC45 and ZXC21 are the closest to SARS-CoV-2 and that they are the “backbone” upon which COVID-19 was constructed.
When asked if the Zhoushan strain is in the PLA’s catalog of viruses and if COVID-19 resulted from gain-of-function or other manipulations in the WIV, Yan said the virus could have come from any one of the PLA’s numerous labs, such as in Hong Kong, Shanghai, or Harbin. Gain-of-function is when viruses are engineered to become more deadly or transmissible. https://www.taiwannews.com.tw/en/news/3981833
20
Cases, based on increased testing, for a Corona virus.
50
like pesticides, biowarfare was well-rooted in Nazi Germany and Japan
Tokyo War Crimes Trials (1946-48), the equivalent in Japan to Nuremberg. According to now declassified documents, US military authorities granted members of Unit 731 immunity from prosecution in return for data they had gathered on biological warfare.
Securing troves of documents on the methods and means of developing biological weapons, their results when used in military attacks, and the individuals who developed them, took on a new significance as the US faced a new adversary in the Soviet Union, and biological warfare was seen as a real threat. https://multimedia.scmp.com/infographics/news/world/article/3101114/biosafety-laboratories/index.html
30
Who (pun intended) is advising PM Scott Morrison. https://australiannationalreview.com/state-of-affairs/who-is-running-australia-jane-halton/
Australia’s representative at the World Economic Forum event201. A short clip from the event, playing out just like they planned. Our rep is at the 4 min mark of this 12 min clip. https://www.youtube.com/watch?v=AoLw-Q8X174
Jane Halton is the key advisor to Australian Prime Minister Scott Morrison on vaccine solutions.
Halton does have a number of credentials:
*Chair of the Bill & Melinda Gates backed Coalition for Epidemic Preparedness Innovations (CEPI) – which the Australian government has given $15 million to!
*Former chairperson of the executive board of the Gates backed WHO.
*Current advisor to Scott Morrison on the National Covid19 Co-Ordination Commission.
Major conflicts of interest here.
90
I was lucky enough to get a comment published on a conservative blog, rebutting arguments of leftests who seem to get any drivel published.
A lot was made of record breaking heat in LA recently. An outer suburb that only has records since the late 40s and was in an area that was still farm land back then. The day wasn’t the hottest day recorded in Downtown LA or other areas of LA with a longer record, such as Riverside which was hotter on a day in 1925 and 1917.
I was rebutted “Not at all. In fact here’s an extra one: it’s now September. Quoting old heat records from mid-summer July to beat a new September record shows a level of understanding fairly typical of climate “skeptics”.”
But September in LA is hotter than July and June when the 1917 record occurred. Funnily, August didn’t have the same extreme temperatures as the other summer months despite being the hottest on average.
More interesting, after looking at http://www.laalmanac.com/weather/we04.php
I counted 24 of the record highest temperature for the date in the months of Jun-Sept were set in the 19thC. The hottest July and August days were set in the 19thC. Only 8 records for the date were set in the 21stC.
So that was rebutted with “That’s irrelevant. We need to know how it’s trending now not 150 years go, also why it’s trending in that direction.” And another linked to a paper https://climate.nasa.gov/files/LAHeatWaves-JournalArticle.pdf
“Heat Waves in Southern California: Are They Becoming More Frequent and Longer Lasting?”
It was written 12 years ago and finds that LA is likely that to have three times as extreme heat waves. It does this by some dubious analysis that exaggerates the effect of a couple of degrees of warming by counting the number of days in row with temperatures above an extremely high value.
What’s interesting is Figure 2. It shows LA has warmed 5°F over 100 years of data (2.5°C) but it’s nice and linear from 1905 to the late 70s. The trend is slightly negative for the next 3 decades. Kind of tells you that LA growing from 200 000 to 10 million, plus huge urban sprawl outside the county, caused the warming, not global emissions.
140
All large urban areas with long records show the same trend.
It is interesting to find a nearby rural or seaside location that has not undergone the same population growth and infrastructure changes.
I looked at long temperature records in remote locations in Australia more than a decade ago that made me skeptical of global warming:
http://www.bom.gov.au/jsp/ncc/cdio/weatherData/av?p_display_type=dataGraph&p_stn_num=047007&p_nccObsCode=36&p_month=13
http://www.bom.gov.au/jsp/ncc/cdio/weatherData/av?p_display_type=dataGraph&p_stn_num=085096&p_nccObsCode=36&p_month=13
Then look at the heart of a large city:
http://www.bom.gov.au/jsp/ncc/cdio/weatherData/av?p_display_type=dataGraph&p_stn_num=066062&p_nccObsCode=36&p_month=13
Urban heat effect is considered to be a trivial factor in increasing temperature trend. We know that because the climate models show that the only reason temperatures increase is due to more CO2.
It is useful to find old images of a city and compare with current images. Or look at the traffic levels. Horses created their own pollution but not much heat compared to a motor vehicle.
Much of Australia’s measured warming is a function of relocating weather stations to airports because they are easy to service and there are not many buildings at airports. However in recent years the LiG thermometers were upgraded to electronic thermometers that have a faster response. The maximum temperature is now influenced by plane engine exhausts.
100
Who knew that planes could have such an impact on global warming; or at least peak recorded temperature.
40
Care to hazard a guess when Port Hedland moved to electronic recording based on this chart:
http://www.bom.gov.au/jsp/ncc/cdio/weatherData/av?p_display_type=dataGraph&p_stn_num=004032&p_nccObsCode=36&p_month=13
Obslow is much more obvious for obvious reasons but note the lift over the old record:
http://www.bom.gov.au/jsp/ncc/cdio/weatherData/av?p_display_type=dataGraph&p_stn_num=005017&p_nccObsCode=36&p_month=13
Mount Isa is not as easy:
http://www.bom.gov.au/jsp/ncc/cdio/weatherData/av?p_display_type=dataGraph&p_stn_num=029127&p_nccObsCode=36&p_month=13
Darwin airport a better indicator of the size of jets using the runway then the conversion to electronic:
http://www.bom.gov.au/jsp/ncc/cdio/weatherData/av?p_display_type=dataGraph&p_stn_num=014015&p_nccObsCode=36&p_month=13
With the advent of automatic weather stations, many of the long term post office based weather stations were closed down and the AWS set up at airports. That fact alone will contribute to global warming.
50
R.B.
I have analysed heat waves for “longer, hotter and more often for the 6 State capitals where most Astralian population and some of the longest T records reside.
Why, I even posted the findings a couple of times on this very Jo Nova blog. Search for “heat waves Sherrington” if you have not already read them. Geoff S
60
On 31st January this year some towers that support the interconnected between South Australia and Victoria went down. SA was effectively its own network apart from skinny link through NSW that meant it has to maintain voltage and frequency within tight bounds to keep that interconnection stable.
A temporary bypass pod the towers was operational by 2 March.
So there were 30 days in a high demand period where SA had lost its big battery – the 650MW, infinite capacity battery otherwise known as Victoria. I found this account of actions, from an AEMO publication, that needed implementing through February to keep SA lights on:
80
All those AEMO interventions came at a cost. The recent AEMO quarterly report details the cost of intervention in Q1 compared with the much reduced cost of intervention in Q2:
https://www.aemo.com.au/-/media/files/major-publications/qed/2020/qed-q2-2020.pdf?la=en
Figure 36 on page 25 has the details. The so-called power system management cost was $310M in Q1 compared with $63M in Q2. So difference of $247M for 30 days of interconnected outage. OR $8M/day.
An interesting aspect of this cost is that it does not show up in wholesale price. It gets levied separately via generators or electricity buyers depending on the intervention. Ultimately consumers pay. It was not levied entirely on SA. Some cost was also incurred in Victoria.
This gives some indication of how South Australia depends on the interconnector with Victoria. It also shows that the only way SA gets away with its high level of weather dependent generation is due to the link with Victoria.
The loss of the Heywood interconnector provided AEMO with a glimpse of its future. The Integration Study reports contains this reflection on the disconnection and resulting directions:
This is a link to the Integration Study:
https://www.aemo.com.au/-/media/files/major-publications/ris/2020/renewable-integration-study-stage-1.pdf
SA is fast approaching another test this spring. Even this early in September, rooftop solar at its daily peak is suppling more than all the generators in the SA network. That makes stability a key issue. The brave new world is coming faster than AEMO can cope.
Forecast generation for SA at 1330 today is 975MW from rooftop solar and 382MW from large scale generators – that presents a power system management nightmare; impossible to manage without the solid link to Victoria. Watch the thin yellow line, rooftop solar, overtake the grid scale generators as it rockets off the chart:
http://nemlog.com.au/gen/region/sa/
70
It was forecast to be sunny in SA today and AEMO must be aware. This is a very challenging day for the SA network and one of many to come this spring. This AEMO direction is now in place for 13th Sept:
This gives some clue why SA needs the 850MW interconnector with NSW so it can use that State as a second big battery to enable the further expansion of rooftop solar.
South Australia is no longer a duck curve but rapidly becoming a lake with mountains either side.
70
RickWill:
As the SA Government is rushing into renewables as fast as they can go, it would help if they were also building their ‘Amazing Grace’ (the interconnector to NSW), or any of the miraculous ‘cures’ like pumped storage/ batteries etc. I haven’t seen any news about construction starting, although I have seen cancellation of a pumped air storage system. Half the synchrous condensers are due to be ready shortly, and the others by the end of this year.
40
The Hornsdale battery has just completed 50% upgrade at a cost of AUD71M. It is now 150MW with 180MWh storage.
One noted feature of batteries is the ease of expansion. They do not take up much room and are environmentally benign. The latter point is a big factor in modern project management. Building a power station or mine that involves moving dirt can take years to get through the environmental hurdles.
The CEO of Rio Tinto has just fallen on his sword over disturbance of aboriginal caves where they actually had the required approvals. Proposed solar farms in the Pilbara could expect difficult environmental hurdles but batteries not so much.
33
Only in the way that a Tesla car is “zero emissions”.
20
No one needs an environmental management plan to buy a Tesla. So the statement is irrelevent.
An environmental Management Plan approved is required to install a grid scale battery but that is a much easier task than getting an EMP for a power station or mine.
21
What.
A.
Load.
Of.
Rubbish!
20
RickWill:
I would have thought that the biggest hurdle was getting the finance. Mind you, if the wind blows strongly and the wholesale price drops to minus $1,000 per MWh then it would be very tempting to top up the battery for release when the wholesale price rises.
That would mean the up-graded battery might supply SA’s total demand for the equivalent of 6 minutes. all we need is about 720 of these “large batteries” to cover gaps in the wind, that’s about $115.2 BILLION, that’s only $67,700 per head of population (assuming they stay around to pay the bill).
30
The next big battery for SA is estimated to cost $1.5bn for an 850MW battery of infinite capacity. It is located in NSW and called NSW.
NSW will then enjoy the same promise of low cost power as South Australia enjoys. It will enable the closure of Liddell and then NSW consumers can enjoy the promise of lower cost electricity while paying more.
40
The pink line on the nemlog chart is the transfer to the big battery, Victoria. The blue line right down the bottom is the transfer to the little battery, Hornsdale.
That gives an indication of how important Victoria is to the stability of the SA network.
As spring marches on, the rooftop solar in Victoria will start to kick in. That could reduce the ability of Victoria to sink the rooftop output from SA. Otherwise known as a dilemma.
40
Minimum demand in SA 13th Sept only 360MW. Victoria is absorbing 380MW, more than the SA demand.
SA wholesale price went negative at 11:30 and wind started curtailing after that.
If there was no big battery (Victoria) then all grid scale weather dependent generators would need to be curtailed. Today Victoria has absorbed around 380MW for 4 hours. That is equivalent to 12 Hornsdale batteries.
It will be fun to watch this infold over the next two months.
If the SA grid goes unstable and is shut down then AEMO are in a position to say they warned of this eventuation. They will be able to say that the perfect weather conditions aligned to cause the event – nice balmy day; not too hot, not too cold; sun almost overhead and no cloud. Just enough variation in the wind to get the destabilising factor from the wind. Sun shining in Victoria so demand there a bit low. Bring on rooftop solar.
50
Victoria price went negative today as well. So the Victorian network is already congested and does not need lunchtime power from SA.
30
Perhaps they could just put a big dummy power sink in the desert and give it a catchy name like “Industry Foregone”
30
🙂 🙂
00
Or perhaps we could follow the NT lead and export it to Singapore.
https://www.pv-magazine.com/2019/07/22/australia-singapore-power-link-worlds-biggest-solarstorage-project-get-government-backing/
Better still how about we export all our politicians and bureaucrats and replace them with monkeys?
40
Along with the solar farms to reduce the length of the transmission lines?
00
Rick,..how do you tell the difference between wind/solar being deliberately “curtailed”, compared to when it just reduces due to the weather ?
Is there some info in the NEM data log that identify’s that managed reduction ?
30
There is an estimate of the grid scale wind and solar curtailment on the NEM Log:
http://nemlog.com.au/gen/region/sa/
When curtailment is in operation it shows as a faint orange dotted line. If you are quick enough you will get Sunday’s data on the log, when curtailment occurred through most of the period that the rooftop solar output was off the chart. The last line in the legend box is the clue – the one titled ‘Curtailment’
AEMO now make estimates of the amount and cost of curtailment. I do not know how they estimate that but curtailment is viewed as an opportunity loss. There is no acknowledgement that it is the natural consequence of high penetration of intermittent energy. That is why they still believe weather dependent power is lower cost than coal fuelled generators.
South Australia is held up as the Greta Thunberg of weather dependent electricity grids. What that story does not say is that high levels of intermittent generation can only be achieved by using Victoria as a big battery.
40
Ahh !,.. thanks Rick
A new feature, it was not present on last years charts.
Is it always wind curtailed, or can it be Solar also ?
You can see why they want to be able to control RoofTop Solar generation, andd get that new interconnector to NSW working ASAP
20
Another thought ..
When “curtailment” happens, do the generators get paid some compensation for “lack of income” , or do they just have to take the hit. ?
California is known to pay other states to take its surplus solar/Wind generation at periods of low demand/high generation,
20
AEMO make a distinction between curtailment and spill; curtailment when it is directed and spill when it is voluntary to avoid taking the negative price. As far as I determine the NEMlog data showing ‘curtailment’ is both curtailment and spill.
Grid solar is often curtailed/spilled. It is particularly clear in Queensland where the grid solar reduces output when the price goes negative as the rooftop starts to crank up most days in winter and early spring but not in the last two days. It usually is evident in SA as well. The grid solar output on Monday 14th was lower than Sunday 13th despite much higher insolation on Sunday. None of the intermittent generators can absorb negative prices below the minus $40/MWh that LGCs can recover. In Queensland, the coal generators bid in a block of energy near the floor price of minus $1000/MWh to ensure they remain dispatched through negative price swings. The intermittents blink first because they are not guaranteed to get it back but the coal can always push prices up to the gas generation price during the peaks to ensure they make a buck. That will end for Liddell when the SA-NSW EnergyConnect link is completed because they will be competing with the other coal generators to make money from the evening peaks.
I do not believe there is compensation for curtailment/spill in Australia. There is some indication it might be on the table going by the fact that the quarterly AEMO reports now estimate the cost of curtailment/spill.
The one bright light in all this is that AEMO have recognised they need to do time based modelling – something I recommended in my submission to the ISP. Managing the system security has become very complex with increasing manual intervention. All the modelling for the Finkel Inquiry and the ISP was based on capacity factors for intermittents with significant reliance on the diversity fairy that some now realise does not exist or deliver when required.
I don’t think the international trade in Europe has the sophistication of the Australian NEM. I think Europe still has wind and solar on priority schedule so Germany sometimes pays for other countries to sink it. I know UK pay wind generators to curtail output rather than paying to sink it into Europe.
When the SA-Vic interconnector was down, both NSW and Vic paid higher wholesale price than SA but the wholesale price does not include the cost of directions and that cost $8M/day in February; a big hit for SA consumers.
40
Okay then, as the precursor to this comment, I want you to go back and carefully read an earlier Comment I made back in early April, now five Months ago, and not long after all this Wuhan Coronavirus ‘problem‘ started. It was me just ‘ballparking’ the future of politics here in Australia, how it would get difficult, and some of them would find reasons to, umm, resign rather than continue, and that comment is at this link.
Okay, here we have the first election since all this started, a State election here in Queensland. Three Ministers have resigned and will not re-contest their seats in the election. (as shown in this typically Labor friendly article at the ABC)
They found, well sort of anyway, reasons to justify their leaving, but it’s just the start. After the election, if the current Government loses, there will be more of them, some on the actual election night or the day after, and others in the following week. You can bet on it.
They’ll take their wonderful Superannuation, and here, remember that political super is the best in the Country, indexed for life, with the greatest contribution from the taxpayer’s purse, at a higher rate than any other, and there’ll be no need for them to draw down their super like so many people in the wider public have done in the last few Months. Also, resigning as a Minister means a higher Super as well, as it’s indexed to their retiring wage, similar to also resigning immediately following the election loss as well, as they were Ministers in that losing Government. They’ll also get all the ongoing, and not inconsiderate perks that Ministers are entitled to, and then the bonus jobs and positions that retiring Ministers get offered, on Boards and the like. (see Peter Beatty and Anna Bligh in recent years)
So, it’s not like they are resigning forever, as all of them will get either their old jobs back (the Doctor) or will get new very well paid jobs plus all they are already entitled to.
It’s not just Labor as is the case here, but even the Opposition if they don’t win, as there will be retirements there as well, and the same will obviously happen as other elections, at both State Federal level come up in the future.
Politics will not be easy for any of them in the foreseeable future, years in fact, so it won’t be the easy ride it once was. Consequently, we might go back to seeing nobodies running for office, and the cream you might expect in your politicians would rather not do what will be basically pretty thankless work.
Wait and watch. This is just the start of it. Politics is a filthy thing and when things get tough, you see just how filthy. You can only spin so much, and the longer I live the more cynical I become.
Altruistic service to the people and the State and Country is the single furthest thing from the minds of these people, but those are still the first words they utter, and utter often.
Tony.
220
“ the longer I live the more cynical I become. ”
I think that is one of the reasons humans are programmed to pass over the rainbow bridge (insert your own euphemism).
Another reason is seeing the cost of things, such as a loaf of bread, and remembering back to when you were 8.
One becomes a Curmudgeon.
40
So true. I’ve noticed that trend over the past decade or so. But understand it’s a viscous circle with an unknown start and a known ending (catastrophic). Votes are not happy but what choice do they have, other than to do the right thing and stop voting for either major party for majority rule in protest. The alternative of a violent uprising is too dangerous but might come to that eventually.
The comment has been made by some in the past that Trump might just walk away and say to everyone goodbye and good luck. Now that he’s declared his running for the next election,it appears he is still eager to continue his work to save America, at least try to. It’s their last chance I suspect. We on the other hand have no chance. We are slowly committing economic suicide in several ways.
20
Do Masks Really Help?
https://www.iceagenow.info/do-masks-really-help-video/
10
Masks are a social accommodation.
They remind people to be nice to one another.
Two meters, 6 feet, 2 shopping carts, or similar are
physical metrics.
Our betters use the phrase “social distancing”, showing they
flunked Sociology 101 and Intro to Physics.
40
A quick look at PCR testing info seems to say that the entire premise of this video – that PCR testing can detect ALL forms of Coronovirus – is wrong. My interpretation is that the unique strain of COVID-19 allows for it to be successfully tested and isolated, and that the video might be confusing PCR tests with Serological Assays. Thus the entire premise of the video, if wrong as it seems to be, would mean that the rest of the video, built upon that premise, is also wrong.
This link provides more detail of PCR testing: https://journals.lww.com/ccejournal/fulltext/2020/06000/review_of_viral_testing__polymerase_chain.22.aspx
20
MODS: This was supposed to be a response to David’s #14.
30
So the Doherty Institute got it right when they found the testing system was 100% reliable in specificity and that operation specificity dropped to as low as 97.5% in one of the labs assessed.
13
Graeham#4,
This report (and many others) question the validity of the current PCR tests for COVID.
Headline – “WHO Coronavirus PCR Test Primer Sequence is Found in All Human DNA”
https://pieceofmindful.com/2020/04/06/bombshell-who-coronavirus-pcr-test-primer-sequence-is-found-in-all-human-dna/
The bottom line is that if the a particular national health agency does the PCR tests with an excessive amount of amplification steps then you will test positive for COVID regardless. The number of amplification stages that are done per test are not actually specified but there is a recommendation, of 40 (or thereabouts). See here for details of the process.
On reading a few reports and medical blogs from the frontline testers they seem to indicate that that anything much more than 35 is moving the tests into the uncertainty area. On top of that the current COVID PCR test are usable but with around 20-30% false outcomes overall.
As this very helpful site on PCR testing says
30
Thanks for the information and links. While I’m certainly no expert in this field, I’m always very careful about attributing an issue to a conspiracy when other plausible explanations can exist, and some of the websites have hinted at a conspiracy. I would have liked to see more medical input on this subject.
41
you need both primers to work to detect anything so this revelation is dead.
Further it is not the primer used in most tests. Dead again.
20
Made in Chyna
30
Hi All. Today is GIVE DANDREWS THE BOOT DAY.
Even if you’re not living in Victoria, and if you want to make a statement about the disasters he has inflicted on all of Australia, then please put out a pair of boots/shoes by the letterbox today.
Cheers,
Speedy
71
The abc has been rumbling around in my brain a bit more than usual lately, having lost an old friend, to what I’m starting to call a cult! I was called a ‘disgusting racist’, for bringing up some contrary views to the blm situation. She had mentioned earlier that day, that she had been having trouble with her TV tuning, and was relieved to have her ‘beloved’ abc news channel back. I hadn’t realized things had gotten that bad, and was surprised at the sudden passion of the discussion, which I moved away from pretty quickly. But the dye was cast. I have been feeding her non MSM titbits for years, no problems, and she was one of only 2 people I know, who seemed to be able to look at evidence, with some rationality. How does the abc manage to not only switch off people’s brains, but cauterize any competing idea streams? OK, laziness – ‘I trust the abc, therefore I will allow them to be my filter, it is ‘Our ABC’ and they really do fact check everything’.(except all the stuff they never mention) I mentioned a few days ago being shocked at one of their promos – ‘this is love,love,love. Your abc.’ It is a magnificent piece of propaganda, gotta hand it to them, but really this is becoming pretty much cult-like. I can not have any discussion with almost everyone I know. If they’re not hearing the party line, a lever seems to be pulled, and a cascade of labels just spews out. Is it fear of betraying their lover? Are they that far gone? They are very steadfast in their views. That’s a nice way of saying dogmatic, and they just can’t see how anyone could have another viewpoint. Cults are supposed to have charismatic leaders, but maybe an internal zeitgeist, and a big mouthpiece, can do the job?
Anyway – abc for cult of the year 2020.
and
We paved paradise and put up a solar farm!
160
Hi FC – I feel for you. The truth will out (eventually) but in the meantime, we have to be patient. A similar situation at the house of Speedy but Herself had the brains to realise that the thing was a beat-up eventually.
Good Luck and don’t stop being nice to Mrs FC!
Cheers,
Speedy
60
Very well put, but the sadness.
My brother and sister who grew up in the same world as me, see it so very differently.
Through the eyes of the ABCCCC.
KK
60
Much like how Hitler came to power; a desire to be told what people LIKE to hear and not what they NEED to hear.
21
In other words, the ABC must be shut down ASAP as they are acting in violation of their own statues. Not only that they are indoctrinating people into thinking the West must be pulled down at all costs, which makes them in effect almost like a terrorist organisation.
101
More Climate Change. Governor Gavin Newsom says the debate about Climate Change is over.
What debate? I don’t remember any debate? Now Climate Change is the only cause of bushfires. Certainly not legislated government neglect by people like Gavin Newsom and Daniel Andrews. Both should be charged with manslaughter.
181
The United States Centers for Disease Control and Prevention (CDC)
Their website says, “The US CDC is one of the major operating components of the Department of Health and Human Services.”
However, it is registered as a “for profit” private corporation.
It is not an independent government agency. It is a subsidiary of the pharmaceutical industry in the form of a public private partnership. It owns patents on 20 or more vaccines. Has $4.6.B sales pa from vaccines.
The CDC is not a public health agency making “independent” vaccine recommendations.
It is not non-political. Director Dr. Robert Redfield, praised the World Health Organization after President Donald Trump announced that the United States will halt WHO funding.
CDC guidelines follow and change with the political wind, eg.
” wearing a mask during prolonged exposure to coronavirus will not prevent possible infection. ”
It claims jurisdiction over all private residential leases! This right is asserted from there remit to control diseases. It appears CDC wants ‘more’, instead of providing reliable auditable disease data.
In May 2020, coronavirus task force member Dr. Birx claimed, “There is nothing from the CDC that I can trust.” ~ The CDC inflates Wuhan flu mortality by as much as 25 percent.
Dr Birx is unpopular from left to right, a possible recommendation.
There are not a lot of sources for this kind of info, least of all gargl, I like-
https://picosico.org/tag/CDCcorruption
very political, humorous and opinionated.
But I would like to see info to contrary. Considering the stakes, in this case the onus of proof is on the defence.
100
Amazing revelation that the CDC makes $4.6 billion from presumably its own advice? Now wonder they support WHO and Dr. Birx has called them out.
90
Interesting.
10
Amazing Indian interview with White House stenographer for both Biden and Trump.
And Joe Biden was previously an off the cuff speaker who was contemptuous of prepared speeches and threw them away now needs a teleprompter for a simple conversation! Now he does not make sense.
There is a rumour that Biden will hand over the Presidency within a month to Kamala Harris. He is clearly falling apart.
The gaffes are getting worse and he cannot debate anyone, which is why Nancy Pelosi said a month ago that there will be no debate, so she knows all about it.
Biden is back to hiding from the press in his basement, Joe Hiden. And everyone in the Democrat party knows it. He is reading prescription ‘jugs’ not prescription ‘drugs’. And he is reading advice aloud, advice which was not meant to be read out loud.
They may have to walk Biden to the finish line, avoid debates and pray he wins on postal vote fraud. It’s getting eerily similar to Weekend at Bernie’s. (Sanders that is). America may be facing an unprecedented election between Donald Trump and a 79 year old man who is almost dysfunctional, whatever his politics.
It’s ironic because age should be their greatest weapon against Trump, except that both Elizabeth Warren and Joe Biden are even older. And elected he would be nine years older than the oldest president in History, Donald Trump who took office at 70.
120
It’s interesting to speculate on what will happen? Perhaps they will get Kamala Harris to debate Donald Trump? Or force a basement debate using a teleprompter, if he can read straight. Pelosi knows all about it.
The election is 3rd November 2020, so 50 days away. The unthinkable is to change candidates. And clearly they have already decided that is not possible. Bernie or Warren are the fall back position, but they are both unelectable extreme socialists like Harris. Plus they lack the fading gloss of Obama. Maybe they will fall back to Hillary for one last try? Desperate times.
91
And if Joe Biden somehow manages to become President, he can withdraw immediately and Kamala Harris will automatically become President. Bernie just has to get to the finish line, somehow. I wonder if they have considered a body double?
80
Then Kamala Harris gets to nominate someone to replace her as VP, the nomination to be confirmed by both houses. So the democrats get a President and VP they want, neither of whom was voted to the position by the people, and probably neither would have been voted to the position.
71
If Biden manages to be elected as President (provided it’s done legitimately) then the Americans will get what they deserve and learn the hard way. I don’t think they are that stupid though, but I could b wrong. We will find out soon enough.
51
TdeF,
IMO that is why Pelosi (and not Biden) came out with all that ‘climate crisis’ claptrap.
The Pelosi “Mother Earth is angry” does three jobs in one —
1. Gives the left-wing arsonists activists cover.
2. The MSM loves ‘Climate Crisis’, it feeds their lefty agenda, especially in California.
3. And it serves as a distraction away from debates about Biden health (for a while).
120
In a previous lifetime, I was working in a state forest close to the Koala Capital of the World. It was a dry, largely inhospitable collection of struggling trees with rampant woody understory weeds that made walking through it difficult. There was no standing water. Apart from the fringes, wildlife inside mainly consisted of tree creeper birds and the common resident predators – goannas up to 2 metres long. They were the rulers, totally unafraid and I’m sure feasted on anything that tried to take up residence on their turf. No kangaroos, snakes, pigs, parrots, bats or furry things visible. But this forest was full of “habitat” trees including species that existed in the 100+ varieties that koalas supposedly like to eat. After spending a lot of time walking through this forest without a single sighting, I have learnt that koalas are fussy eaters, much like my grandkids, viz:
So in dry areas, the eucalyptus oil content is too high and makes the leaves unpalatable for the poor furry things and they get on the ground and go looking for water to drink and sweeter tucker. One would hope that the NSW Govt. will take this into account when they put together their “Koala Likelihood” maps and not declare habitat areas based on tree species alone.
110
It may well be as you say: too much oil; too little water. Lousy habitat.
There are WAAAAY more koalas than the koala boffins say there are. Koalas are like the barrier reef and the polar bears and the penguins — going “extinct” every second year, then miraculously recovering ready to go “extinct” again the next year.
They have started using dogs for scat detection, finding 80% more koalas than professional koala spotters can find. So that’s 80% more in their prime habitat that they didn’t know about.
https://www.australiangeographic.com.au/topics/wildlife/2019/11/meet-bear-the-koala-detection-dog/
And then there’s all the others they assumed didn’t exist:
“. . . the rate of koala occupancy in the New South Wales hinterland [ie not the main coastal koala habitat] is up to 10 times higher than previously thought.”
So that’s 1,000% more out there.
https://www.abc.net.au/news/2018-07-30/koala-tech-reveals-higher-occupancy-than-expected-in-nsw/10052274
And remember, it was 15 years after settlement before the first koala was ever spotted by a European in 1803, so uncommon were they back then due to native predation and native landscape management practices. They are not about to go extinct any time soon, not even on a local scale.
As Vic Jurskis has pointed out, koala populations historically boom after big fires. He made a submission to that effect to the NSW Koala Inquiry in December last year before the main conflagration hit. I’m sure ignorant Gladys will lock up as much land as possible to ensure we have more conflagrations and make life as difficult as possible for the landowners.
https://quadrant.org.au/opinion/doomed-planet/2020/02/bushfires-and-koalas-its-not-that-simple/
81
Meanwhile the local wildlife sanctuary (Cleland) is delighted to have some koalas from Kangaroo Island. Only a year ago there was some discussion about culling the numbers there as they were “in plague proportions”. The recent fires did that (about 25%). They were introduced into the Island in the 1920’s and were not native there.
But the rejoicing wasn’t about “saving” some, but because the population was chlamydia free, sexually transmitted, unlike those on the mainland.
40
The Siracusa Principles, adopted by the UN Economic and Social Council in 1984, and UN Human Rights Committee general comments on states of emergency and freedom of movement provide authoritative guidance on government responses that restrict human rights for reasons of public health or national emergency. Any measures taken to protect the population that limit people’s rights and freedoms must be lawful, necessary, and proportionate. States of emergency need to be limited in duration and any curtailment of rights needs to take into consideration the disproportionate impact on specific populations or marginalized groups.
On March 16, 2020, a group of UN human rights experts said that “emergency declarations based on the COVID-19 outbreak should not be used as a basis to target particular groups, minorities, or individuals. It should not function as a cover for repressive action under the guise of protecting health… and should not be used simply to quash dissent.”
The Siracusa Principles specifically state that restrictions should, at a minimum, be:
provided for and carried out in accordance with the law;
directed toward a legitimate objective of general interest;
strictly necessary in a democratic society to achieve the objective;
the least intrusive and restrictive available to reach the objective;
based on scientific evidence and neither arbitrary nor discriminatory in application; and
of limited duration, respectful of human dignity, and subject to review.
Human Rights Concerns
Protect freedom of expression and ensure access to critical information
Under international human rights law, governments have an obligation to protect the right to freedom of expression, including the right to seek, receive, and impart information of all kinds, regardless of frontiers. Permissible restrictions on freedom of expression for reasons of public health, noted above, may not put in jeopardy the right itself.
The BLM protest hypocrisy is just ludicruous given that most of the malcontent followers probably hadn’t even heard of BLM before the death of Floyd.
So…can anyone tell me in view of current knowledge on Covid as to how it isn’t much worse than the flu death rate how Fuhrer Dan Andrews can’t or hasn’t been SACKED?
I would expect and hope there’s a massive class action suit against him and his lackeys.
50
“Why has the Fuhrer not been sacked?”
Three ways:
1. By the state Governor- appointed and dismissed by, and is a follower of the Fuhrer.
2. By Parliament- majority are of the same party, anyway not in session and can be recalled only by Him.
3. The public, voting or not- have been converted into sheep by the CCP19 scare. These are not the Eureka descendants.
But what about the economic disaster? The Fuhrer is borrowing big (today’s news) to throw money around, all will get a piece, all will approve, it is ‘other people’s money’, the bail-out will come from the Federal Government, or, from China.
51
Bye all, u r boring
514
Goodbye Peter. One hopes you find a more interesting place that keeps you occupied.
141
What a horrible thing to say Peter. The good people here have spent their valuable time trying to educate you and all you can do is insult us.
101
Ahh ! ..if only that were true .
But. For one do not believe you !
100
“Caption This — Winners”
http://www.smalldeadanimals.com/index.php/2020/09/13/caption-this/
20
Schizophrenic German Wind Power Output In August, Plagued By Wild Volatility
https://wattsupwiththat.com/2020/09/13/schizophrenic-german-wind-power-output-in-august-plagued-by-wild-volatility/
10
RicDre and all of you,
this situation in Germany is in fact nothing new at all.
Back in 2009, I found some data on wind power generation in Germany that confirmed my thinking at that time, that wind power generation was an abject failure, no matter on what scale.
All that HAS happened is that as the Nameplate has increased by HUGE amounts, the SAME problem that existed at that time has increased on the same scale and ratio as it was back then.
Prior to this, I was still reticent to write that wind power was a flop, because I still thought after many Months that something would come to the surface that would prove me wrong.
Nothing like that happened at all, and in fact, everything I saw confirmed that I was on the right track, and that wind power generation was actually an epic fail.
At the time I found this German data, I wrote two Posts on the subject, dtaed at the top of each Post in October of 2009, the links as follows.
Wind Power – Epic Fail
Wind Power – Epic Fail – Update
Now, keep in mind that EXACTLY the same thing is happening here in Australia. This is not isolated, as EVERYWHERE wind plants are constructed, it is exactly the same.
In 2009, I referred to wind power as an Epic Failure.
NOTHING has changed.
Tony.
140
It appears that you are denying the existence of the diversity fairy. You need to have a good chat with AEMO chief Audrey Zibelman. She is a firm believer in the diversity fairy and all will be better with stronger interstate links and some bigger batteries.
A worrying sign is that AEMO are now putting an economic cost on curtailment. They are estimating the ‘loss’ defining it as a lost opportunity. From the AEOM Q2 report:
https://www.aemo.com.au/-/media/files/major-publications/qed/2020/qed-q2-2020.pdf?la=en
In an interview:
So these are the lowest cost but they need scullions spent on the network with interconnections, storage, spinning inertia and fast response automatic control systems in addition to 100% dispatchable generation to extract that ‘low cost’ electricity. WHEN WILL SENSE PREVAIL OVER STUPIDITY.
70
A Crisis in the making going unseen!
I was on the phone with the manager of a very local charity that I donate to from time to time. She had called us to ask if we
could stretch a bit this year…a bit more actually as we had already done a couple of Covid Specific things. I asked if Covid was getting
worse. No, was the answer, the Covid load is actually decreasing as folks are finally getting back to work. he issues is BLM.
?????
It seems that if you run a charity, you stat your year with a penciled in budget with regular contributions expected from local companies who
have supported you year after year, many with annual events, or cooperation with the company in sponsorship. It seems that this year, in a rush
of emotion, Bigots Loving Marxism siphoned off a lot of money, and is certainly not returning it to any charities that have traditionally supported
the community. Company after company has told this manager that they pretty well tapped out their giving with a BLM contribution ‘they couldn’t refuse
to make under the circumstances’….and local giving can’t really be expanded in a Covid year.
SO insteadof a local food bank, something else is being supported. Id’ expect the same thing is happening on a larger corporate level thos I have no personal knowledge….
did BLM siphon off money meant for the United Way, and to what substitute purpose?
If the Nature Conservancy or the Sierra Club or GreenPeace get stiffed for this reason we may hear of it….Climate change politics being the only true existential threat we face;
otherwise a lot of good and useful folks are being starved of funding by some I find a lot less desireable, and who are certainly a lot less accountable. There is a lot of money sloshing around funding a lot of very antisocial behavior. The same displacement seems worldwide, if emotional contributions to new and shady groups displace traditional and
proven charity, with the news media totally uncurious. To me, charity at home is a part of the civilization we are allowiong to go to waste.
120
Flying a dedicated BLM core team from city-to-city to incite riots is expensive. BLM team would not be able to fill the evening news slots with people behaving badly if they were not well funded.
‘Taking the knee’ has not been part of the current cricket series between England and Australia. I think BLM is evolving to its ugly side. The phrase is inherently racist. No one should support such blatant racism.
110
→This← is like almost remembering Déjà vu all over again 🙂 Why the missing episodes? Rod Serling fans needs to know.
00
13 Sept, 2020, Senator Malcolm Roberts: While in Noosa last week, I caught up with Jennifer Marohasy (and Peter Ridd) who gave our group a tour of the coast to demonstrate that there have been much larger sea level falls in the past compared to the small sea level rises today.
https://www.youtube.com/watch?time_continue=165&v=QApjS_WgTsc&feature=emb_logo
90
Good news from NOAA (for a change)
https://www.npr.org/2020/09/12/912301325/longtime-climate-science-denier-hired-at-noaa
Legates is great.
NPR not so much.
41
There’s a globalist organisation called the “Strong Cities Network” which Melbourne city has signed up to. I don’t know much about it yet but I think it’s worth looking into. None of these globalist agreements are good for anyone but the Elites despite their supposed or claimed good intentions.
141
Just googled it
https://strongcitiesnetwork.org/en/
Oh dear.
40
Very good interview with Lord Sumption (UK) about C-19 lockdowns, from May, 33 mins.
https://youtu.be/Qd5sF1ZP0IY
30
CA Governor rants about wildfires due to climate change. Hopeless?
https://www.cfact.org/2020/09/13/wildfire-watch-california-governor-newsoms-unscientific-climate-rant/
31
Have just come across Ivor Cummins’ updates on CV19.
Viral Issue Crucial Update Sept 8th: the Science, Logic and Data Explained!
Well researched, good explanation of why Sweden’s results are different from the rest of Scandinavia, there is no second wave, highlights the seasonality of the pandemic (in the same was as previous, wonders why current experts seem to have forgotten the good work of Hope-Simpson and highlights the hazards of a focus on Casedemics.
10
Daniel Andrews, Victoriastan Premier, must publish the scientific premises -if any- on which the world’s strictest, most business destroying and human rights violating lockdown is based.
121
Give it a few more months of the same behaviour and as a result the state gets closer to bankruptcy then he will have to deal with a very angry public.
81
Yes/no. Feds will bail them out.
00
Apologies to everyone, but I’m having difficulty keeping up with things.
Did someone here post an article or other information, to the effect that part of Dr. Fauci’s “opposition” to the HCQ+zinc+azithromiacin is due to his partial ownership or stock interests in a pharmaceutical company that is developing one of the Covid vaccines?
If this is true, then it is something that needs to be proclaimed as far and as wide as we possibly can, and the sooner the better. I want to contact one of my US Senators (whom I personally know) and be able to point him to definitive information, with the aim of impeaching Fauci’s credibility to denounce the potential treatment for the ubiquitous “bug”.
Thanks,
Vlad
90
G’day Vlad,
I’ve certainly seen the assertion, and some things that may qualify as evidence, but I haven’t attempted to save any of that especially. I’ll try to find something, but it may take some time, as measured in days. Hope someone else has a better filing system.
If I find something useable as evidence ( IMHO ) I’ll post it here.
Good luck,
Dave B
40
G’day again Vlad,
This may be useful and covers my knowledge/understanding pretty well:
https://pjmedia.com/columns/stacey-lennox/2020/06/20/what-if-i-trust-science-and-dont-trust-dr-fauci-n551584
…
Will keep looking.
Cheers
Dave B
20
More, and maybe more definitive:
https://onenewsnow.com/perspectives/bryan-fischer/2020/04/27/fauci-knew-about-hcq-in-2005-nobody-needed-to-die
Cheers
Dave B
20
And this one is worth close study:
https://omnij.org/Gilead:_Twenty-one_billion_reasons_to_discredit_hydroxychloroquine_(ORIGINAL_ARTICLE)
Cheers
Dave B
30
Howdy David-of-……..
Many thanks. Stunning reversal of Fauci on HCQ. Looks suspicious to me. Should be enough to get our Senator, who, by the way, is also a physician (orthopede), interested. I know Senator Barrasso remembers me, and some of his staff even know me by name, so this might be intriguing enough to get some questions asked.
And, Mr. (or Ms. ) Gee, whoever or whatever the “staff” is, to which you made reference, the same idea goes: there’s a swamp, and it’s quite large, and is not confined, at this time, to a single agency, staffer, department, or what have you. Something is NOT right. A lot of somethings are not right. One item being, ‘not right’, is one too many, and there are a plethora of things not right. For whatever reason, people died, and at least some of them did not need to. Of course we all die, it’s just a question of when, and how (Wm. Wallace). So even one needless death is one too many. Only the swamp lives, and it needs to die, sooner, rather than later.
My Regards to all,
Vlad
51
My pleasure Vlad.
Within this post, at #8, David Madison posted a link to an interview by Dr Mobeen Syed with Dr Vlad Zelenko, and I think that video, though long at 66 minutes, could be useful to you and your senator.
http://joannenova.com.au/2020/09/weekend-unthreaded-326/#comment-2364598
…
The direct link is:
https://www.youtube.com/watch?v=MhLD1P5nH30&feature=youtu.be
…
Two things: Starting at 13mins 40, Dr Z describes some of the opposition to his protocol, including by pharmaceutical companies; and
both doctors would be good contacts for the senator.
Also, Zelenko was interviewed (I think it was in May) by Rudy Guiliani, who may be a valuable contact, although that interview itself concentrated on the protocol and how he reached it.
Cheers
Dave B
40
Evening Vlad,
I just posted this in Jo’s Thursday Unthreaded, at:
http://joannenova.com.au/2020/09/thursday-open-thread-20/#comment-2365660
It’s a different example of his withholding of important information, while looking after himself. My be useful.
…
Evening all,
I found this episode from Dr John Campbell particularly interesting for his discovery and comment about Dr Fauci. These are the notes I took, after I’d followed his reference to the Instagram interview of Dr F:
…
Dr John Campbell “Some Good News” 27 mins
At 18:41, Fauci is using vitamin D supplement!! !!!
https://www.youtube.com/watch?v=TZ7vPxWC-3Y
The Fauci reference, 37 mins:
https://instagram.com/p/CE7tWzinTI8/
and the words:
“If you are deficient in vitamin D, that does have an impact on your susceptibility to infection, so I would not mind recommending, and I do it myself, taking vitamin D supplement.”
That conversation starts at 31:37 in the Instagram interview.
There is no further discussion on it.
…
He was responding to the question “What can we do to boost our immune system?” (My shorthand version.) His initial answer was “No”!
Cheers
Dave B
10
too obvious to be true and if other experts and staff near his level disagreed they would speak out.
13
Greetings, Gee:
I’m not 100% certain I would agree with your statement, to the effect that his staffers would speak out. If there’s one thing that has become certain, it is the existence of the “swamp” in D.C., and Fauci and his staffers would be in it up to their eyeballs (or, perhaps in your case, Aye-balls … … … ). Chances are, whatever they know, if anything, they’re not willing to part with their governmental benefits and paychecks, and would rather keep quiet. Rocking the boat can bring down some fairly serious consequences, and faster than warp factor 10, in D.C.
You may be right; I honestly do not know, but would like to have knowledge of the source of Dr. Fauci railing against hydroxychloroquine. If there is even the slightest chance that HCQ with ancillaries will prevent the worst effects of Covid, why would anyone be against it?
Regards,
Vlad
71
I don’t think that is right and I didn’t specify just staffer, though the stafnear his level have agency and this agency is not classic swamp.
08
I wish I hadn’t used Agency with two different meanings :\
18
Apologies if this has been posted before. This video is an update, by Ivor Cummins, of his earlier videos. Really interesting presentation of the data and facts relating to Covid. Mainly related to European data.
One, among many, interesting points was that those countries who were hit hard, eg Belgium, had a below average death rate (for them) in the previous 12 months and visa versa for those that have not been affected so much.
It is well worth the 37 minutes of viewing.
https://www.youtube.com/watch?v=8UvFhIFzaac&t=2s&ab_channel=IvorCummins
30
Be prepared for the next big ideas from the Left when destruction of cheap power production doesn’t save the planet. Including but by no means limited to:
1) Depopulation. That’s why the Left are heavily promoting euthanasia, even for depressed people. Also, the Chinese have already shown a virus can infect everyone. All it needs now is a lethal payload engineered onto it plus the development of vaccines for the Elites.
2) The deliberate lowering of our standard of living, except for the Elites. E.g. the replacement of delicious steaks with plant or insect substitutes, the downsizing of cars (including reduced range and ease of refilling by the promotion of electric cars), the downsizing of dwelling size and increase in population density, depopulation from the countryside for the purpose of “rewilding” etc..
3) Curfews and restriction of movement such as I’m Victoriastan.
91
That’s enough to destroy our economy and our way of life. Who needs enemies from abroad when we have so many locally?
40
I meant “in Victoriastan” not “I’m Victoriastan”. Stupid spelling checker changed it without me noticing.
40
Jo,
ever thought of putting up a quick thread with a basic run-down of PCR and what it does? With maybe a couple of links to clear explanations.
The statements above questioning the technique display a lot of ignorance. I’m all for questioning it – which I’ve done in scientific publications though not about these particular test- but the starting point has to be some sort of knowledge otherwise one has to go back to square one to explain why the question makes no sense.
There seems to be a lot of “what is the PCR test? no one will explain it so I am suspicious” or “PCR is not a clinical test so it is rubbish” (true, it is not, all it does is detect virus genetic material to help with a clinical determination).
We are getting a lot of comments reporting that the test is this or that or someone (out of context) once said it can’t do this therefore it not true. Like if one car breaks down no one should ever drive any car.
43
I think concerns are:
1) It’s specificity. How accurate is it at detecting SARS-CoV-2 and does it give false positives for other human coronaviruses? RickWill and Graeme#4 commented on that question above. Also, does it test for and identify different strains of SARS-CoV-2 and is the strain recorded in data? There is a suggestion of more than one strain and the strains are alleged to have different lethalities. It would be helpful to know which strains are infecting people and how and where they are being spread.
2) What is the relevance of a positive test anyway, assuming it is SARS-CoV-2 that is detected? A positive detection counts as a “case” and the “number of cases” is used extensively but if the patient has not, does not and will not develop clinical symptoms, of what relevance is it? Obviously, if a patient does have clinical symptoms it might confirm a diagnosis but then they are obviously sick anyway. Even Fauci has said there is little chance of asymptomatic people spreading the infection so testing is not about finding asymptomatic spreaders apparently.
50
David, when did Fauci make that claim?
June 10th
Dr. Anthony Fauci says WHO’s remark on asymptomatic coronavirus spread ‘was not correct’
https://www.cnbc.com/2020/06/10/dr-anthony-fauci-says-whos-remark-on-asymptomatic-coronavirus-spread-was-not-correct.html
https://whdh.com/news/fauci-says-the-whos-comment-on-asymptomatic-spread-is-wrong-heres-the-difference-between-asymptomatic-and-pre-symptomatic-spread/
23
Jo, Fauci said it here.
https://youtu.be/TDFsWybjkmg
50
Time spent discussing what certain sources have said is wasted.
Fauchi- seriously compromised by links to Bill Gates, WHO, pharma companies and ownership of patents. Recent statements approaching Gaia worship may indicate an exit strategy.
Imperial College- a once truly great establishment destroyed its reputation by Carbon Change Scare alarmism, then it housed Ferguson of the Model.
The Doherty Institute- a very politically active leader dominates.
40
I thought this was worth reading . . . .
https://blog.nomorefakenews.com/2020/09/10/covid-diagnostic-test-worst-test-ever-devised/
40
false posities of some sort are possible but there is evidence against it. If you look around a very large number 100s of 1000s now of further genome testing from positive samples has not turned up another virus. If it happens it is rare to the point of irrelevancy.
The false positives most likely to happen are from cross contamination and artefacts, though the latter of which will have some characteristics that give it away so that a second test is done.
21
the sequencing and matching strains to cases is what will allow determination of whether there is a link. Once that is established the best technique to then detect which strain a person has so as to inform clinical decisions is (oh no!) PCR
00
I responded but am waiting for comment to be released from moderation.
00
Try This Gee Aye
https://principia-scientific.com/the-covid-19-pcr-test-is-key-to-the-pandemic-fraud/
or this :-
https://journals.lww.com/ccejournal/fulltext/2020/06000/review_of_viral_testing__polymerase_chain.22.aspx
30
I was right to be afraid to hit those links. That is pure garbage written by and aimed at people who have no idea whether they are being given good information or not.
04
Slithers, thanks for the refs. I think it was from the second ref I got,
https://mdvrdrmnblog.wpcomstaging.com/pcr/
Test procedures in wide use can have critics. In the case of pcr testing the ramifications are so serious that criticisms should be taken seriously. Defenders of the test try to swamp opposition with jargon or insult rather than deal with each element at a time. The report from the Doherty Inst is a test to validate a device manufacturer not a test of does the instrument do what pcr is now claimed to do.
Consider the arguments of the HCQ opposition, double blind trials etc. Yet where are the specific tests of pcr in detection and quantification?
Can it be claimed that it is there when the ‘it’ is not universally defined?
Does it detect decayed fragments? Clearly yes, as positive results come in from patients who had symptoms more than 28 days before.
Does it quantify? No, but it could, turn up the amplification until there is a positive reading, report the level of amplification not the positive result.
Quick opinion- 40 means negligible, 30 means some.
However I am not convinced that what is detected is what is claimed to be there.
30
why are the ramifications serious? PCR detects the presence of viral genetic material. That’s it. It does it well. Any serious ramifications are not due to a fault of PCR but of how you interpret it.
01
Viral Genetic Material!
Mmmm, I understood genetic Material required Genes, not nucleotide strings but those famous helix like structures..
DNA genetic replication by splitting and reassembly low chance of errors.
Can parts of the human DNA exist as single strand RNA?
The sequences of published Viruses are RNA strings, that are not genetically produced, or re-produced!
RNA re-construction with the inevitable errors aka Virus with high mutation rate are strings of nucleotides!
The ramifications of the PCR tests are the implications of Amplification. Rinse and repeat, rinse and repeat until you get the answer you were looking for!
20
arrg nothing you are writing makes sense. PLease please do some reading before claiming things are not possible. The stuff you are refuting was worked out 50 years ago. It did not just pop up when covid appeared.
In humans (for example) genes are made up of nucleotides in a sequence in a double helix. The DNA from one strand of the helix is converted to RNA sequence for the purpose of creating proteins (look up tRNA and ribosomes). The DNA code corresponds to amino acids. I know this is hard.
RNA and DNA can both act as genomic material. RNA viruses plug straight into the cell machinery for producing proteins. Your homework is to find out how an RNA virus can reproduce.
00
Don’t give up and go away Gee Aye; I’m sure you’ll eventually hit upon the words which will enable us all to share your certainty about the PCR test. In the meantime I’m suspending judgement principally because of your assiduous contradicting of those challenging the test’s validity.
30
Serp… every test ever invented to test anything has weaknesses and needs to be interpreted and used correctly. If it is deficient it should not be used.
Slithers, I have come to realise, is not questioning its validity from any knowledge base. He/she is just putting together a bunch of things that don’t go together and arn’t relatable to the actual test so they don’t count as challenges. I don’t know why they are doing this but it has come to the point that my time and the blog’s topic don’t justify this effort.
01
You are partially right Gee Aye, I am Not questioning the tests validity!
I am questioning the conclusions reached by people who are using an indication as a diagnosis!
People who test positive to the PCR test should be isolated and other more accurate means of assessing their infection or non-infection state, like fever, cough, X-ray, ct scan and repeat PCR tests should be done.
https://www.9news.com.au/national/coronavirus-nsw-outbreaks-newmarch-house-sydney-new-covid19-case-aged-care-home-news/b46af2e1-2df7-40fa-ac61-1d1fcec37c1b
10
Gee Aye, I think of your asking Jo if she’d “ever thought of putting up a quick thread with a basic run-down of PCR and what it does”, as being a great idea. I’d love to see what she would come up with.
Below, from the article by Jon Rappoport that I linked above.
“Here, from Canadian researcher David Crowe’s bombshell paper, FLAWS IN CORONAVIRUS PANDEMIC THEORY, is a key quote about the PCR test [5]:
“A review of 33 RT-PCR tests for COVID-19 approved under US FDA Emergency Use Authorizations showed a wide range of differences in what the tests were looking for and how they decided whether they had found it. The tests look for a variety of different segments (‘genes’) of the presumed COVID-19 genome, that only amounts to about 1% or less of the total genome, which is about 30,000 bases. Perhaps the worst feature of the tests is how they decide whether the sample is positive if more than one [‘gene’] segment is being looked for. Some tests look for only one, so it must be present for a positive. But tests that look for two segments are split between those that require both to be present and those that require either one for a positive. Some tests look for three segments but only require any two to be present, while one test insisted on all three. Tests that allow a segment to be undetected raise the question of how it can be said that a virus was detected when an important part of it was missing.”
If the PCR is a uniform standardized test, a rabbit is a spaceship.
Speaking of lack of uniformity in test results, here is a quote from Stephen Bustin, who is considered one of the foremost experts on PCR in the world. The excerpt is from his 2017 article, “Talking the talk, but not walking the walk: RT-qPCR as a paradigm for the lack of reproducibility in molecular research” [6]:
“Awareness of variability problems associated with PCR has been long-standing, with the first report describing inconsistencies with replicate and serial specimens evaluated within and between laboratories as early as 1992. The lack of a theoretical understanding of the dynamic processes involved in PCR, especially with respect to the amplification of nonreproducible and/or unexpected amplification products, was also highlighted decades ago. These observations and the resulting implications are largely disregarded.”
20
Slithers- thanks for the 9News ref. It confirms that the test will show a person as positive even when no longer infectious.
10
“”why are the ramifications serious?” Thanks for asking.
A valid point to make without knowledge of recent events in Victoria where test results lead to police knocking down doors, imposing curfews, destroying jobs, and handcuffing pregnant women in their own homes, and etc.
“how you interpret it”
My interpretation has not got thru to CMO Sutton yet. Different views appear to be held by power hungry demagogues.
20
Gee Aye,
your failure to recognize the reference to 92 Degrees C demonstrates your ignorance about the PCR test.
and yes I should have said 94-95 degrees C. I apologize for working from memory and not looking it up.
The other signification temperatures are 50-56 and 72 degrees C.
Can you find out why these specific temperatures are so significant?
It may help you understand the inherent clinical difficulties of arriving at a definitive answer or an indication of the presence of SARS-CoV-2 in a Sample subjected to a PCR test.
10
idiotic and annoying.
I run PCRs daily. Why did you write 92 (or 94)? Without other words around it, it is just a number.
yes annealing has a much wider range than 50-56 though that is a sweet spot. The enzyme optimum is often 72 or 73 though some other polymerases differ.
00
I’m not able to comment on this but am curious about the term “annealing”.
Does it relate to a period of heating a test sample to promote a reaction?
00
Hi KK,
The annealing process used in the PCR test process is exactly the same as used in the metal industries to change the properties of the ‘SURFACE’ of a metal object.
“During the annealing process, the metal is heated to a specific temperature where re-crystallization can occur. At this stage, any defects caused by deformation of the metal are repaired. The metal is held at that temperature for a fixed period, then cooled down to room temperature.”
Thus in the PCR process the soup is allowed to cool at a controlled rate and then re-heated to the specific temperature and again allowed to cool, this is done 30 to 40 times, which explains why one needs to know how many times the process has been done. It also explains why the process can NEVER be faster than the current time interval of 12/24 hours. It has not been established how long each of the heating and cooling intervals are. This depends upon the amount of material in the sample which will always vary.
In a metal the annealing is altering the surface properties of the metal. It is rare to need more than a few annealing cycles. In the PCR test, the annealing is making the bits of RNA able to combine to form bits of DNA. The number of times the annealing is done is what ‘AMPLIFIES’ the amount of DNA that is produces so as to be detectable as specific quantities of the DNA that is being looked for.
A surface smoothing process Jagged RNA to smooth DNA.
The heating and cooling has to be very precisely controlled for the anneling to make the bits of DNA out of the bits of RNA.
00
what rubbish. Please Keith find a reliable source of information.
00
KK please notice that Gee Aye seems to be following the same song book that PF uses make a lot of noise with out any substance.
this reminds me of an old saying,
‘Empty Vessels make the most Noise’.
20
Well, if we are being Picky” and finding errors in others comments……
Whilst i have no experience of medical testing proceedures, i do have a little knowledge of metals heat treatments, and i can assure you that “Annealing” a metal object is NOT done to alter the surface properties,..but quite the opposite ..it is done to reform the INTERNAL grain structure of the metal.
https://www.metalsupermarkets.com/difference-annealing-tempering/
30
Yes.
00
Hi Chad,
I accessed the same link before posting and drew a very different conclusion.
The formation and machining of metals deform the SURFACE. The annealing process renders that surface better able to further processes.
Yes the surface is not the only part to be influenced, the annealing process is not just to the surface molecules, but that is where the effect is most useful!
The denaturing of DNA separates the smooth helix surface into jagged edged RNA, the annealing process enables bits of jagged edged RNA to combine into smooth bits of DNA, hence the strange name of the process.
00
Hi Slithers, thanks for the biological ” annealing” outline.
I think that the term annealing is inappropriate to biology; why couldn’t someone have picked a more original term.
The metallurgical one ? Surface ?
00
Hi Gee Aye,
I did not just refer to 92 degrees C. I referred to Soup making at 92 degrees C.
Which was from memory I should have used 94.
This link describes in great detail the actual process.
https://www.yourgenome.org/facts/what-is-pcr-polymerase-chain-reaction
Please notice the differentiation between SARS-CoV-2 and Covid-19 as mentioned in this post!
The one off per sample used in the ‘Denaturing’ process that occurs at a controlled temperature of 94 degrees C is making soup of the cells extracted from the nasal passages of the test subject.
The extraction of the sample collects mucus and cells, including any viral load that is present, from the nostrils, the addition of chemicals and the application of heat causes the DNA of those cells to break down into separated RNA strand fragments, which by the way DO NOT REMAIN as whole strings!
The Patient has to be suffering from Covid-19 for the virus RNA to be present in the nostrils or perhaps be in continual close contact with a Covids-19 infectious person. There is evidence of family members testing positive while other family members test negative. The family of the TV floor manager springs to mind, his wife and two daughters got Covid-19 over an extended period he has not tested positive ever!
So the soup contains a mixture of bits of RNA from the patients cells and perhaps some from any viruses that happened to be present. ANY viruses!
The rest of the PCR test process is then applied, the samples being tested for are added and the heating and cooling process is done 30 to 40 times to AMPLIFY any and all bits of RNA from the original soup.The process causes the bits of RNA to combine back into DNA thus joining bits of virus to bits of human cell RNA. The final result of the newly formed combined DNA determines the presence of absence of the targeted substance(s).
The conclusions are then made and of which there is NO DATA!
But Police bang down doors and lock up people based upon information that is NOT specified other than ‘Tested Positive’!
As a person who does PCR tests daily perhaps you can enlighten us as to how many amplification steps are made and how many SHORT samples of SARS-CoV-2 RNA are used in the comparison?
The number of times the sample is amplified is critical.
The number of introduced RNA samples that is being looked for is critical.
The match ratio of the samples is also critical. None out of three equals negative.
One out of three, or two out of three, or three out of three, should have a major significance to the person making the conclusion as to the presence of SARS-CoV-2 in the sample.
This also raises the question of INGESTED SARS-CoV-2 where the person does not yet have Covid-19, so gets a negative report but the next day develops Covid-19 and becomes infectious!
This then begs the question as to where the introduced samples of the ‘So Called’ SARS-CoV-2 that is being tested for.
Are these samples constructed to a specific sequence that matches the purported RNA structures of SARS-CoV-2, or are they samples taken from people who Died with or from Covid-19?
In Short, anyone can dive a bus through the accuracy of the PCR test when it is used as a DIAGNOSTIC instead of an INDICATOR of the patients status as being infectious with Covid-19!
All questions replied to, but I do expect links to any contrary propositions as to the use of PCR testing that causes people to be locked up!
Sorry for the length of this post.
20
Fascinating. Come back when you have a coherent critique and once you’ve worked out what a DNA sequence is.
00
Why don’t you go away and study the structure of DNA and what denatured DNA is (RNA) looks like at the molecular level.
Your much self vaunted knowledge with-out any links has become startlingly obvious.
00
links on ssDNA or RNA are easy to conjure up slithers. Your bizarre disconnected statements are testament to how much attention I need to further pay to you.
00
Hi Gee Aye,
Don’t read this as you may learn something.
https://www.zerohedge.com/medical/rogue-chinese-virologist-joins-twitter-publishes-evidence-covid-19-created-lab
I contains verifiable scientific facts and proposes a theory that is not easily refuted.
10
Conservatives were apathetic and got the situation in Victoria. If they remain apathetic the whole country will go the same way.
60
Brett Sutton is still dropping bombs. Today he let slip that he would talk to family groups in the outer east of Melbourne that was identified as a CV19 hot spot. His specific qualification for this was that he had spent time in Afghanistan!
60
Sutton Hoo went there with Quacks Uncorralled and has written in The Medical Journal of Australia of December 2003; not being of the AMA nor a subscriber I can say no more other than to suppose he was not captured and used as a human shield a circumstance which has been a boon to climate science.
00
I wonder when the CO2 trend at Mauna Loa is going to acknowledge the world wide collapse of industry, air travel, sea transport and vehicle traffic? given we are a major driver and all. I guess there are rationalisations a plenty, with lots of handwaving and rainbows and unicorns showing why nothing happens. I will file with heat causes cold, vanishing ice and unprecedented tipping points.
70
I think China manufacturing output has increased. Certainly Australia’s iron ore shipments have increased. Twiggy is looking to expand his mining operations.
China hit record electricity production in July 2020, producing 680TWh for the month. More than 3X Australia’s annual output in 12months. Not much of China’s electricity comes from weather dependent generators.
International shipping has not changed much.
Air traffic down a bit – not much else.
I expect there has not been much change in fuel consumption globally.
50
I wonder when the Data which is a totally UN-natural Saw-Tooth waveform can be explained?
What in the world can explain the sudden change from positive going to negative going with the seasons.
They are a sinusoidal, cause and effect where I live.
What is the cause of the Mauno Loa data?
How often do they have to change the reference samples against which they make the actual measurements?
40
Slithers… seriously… look it up. It is not mysterious.
21
‘Why is there a zigzag pattern to the CO2 concentration data? What could be causing this to occur?
‘There is a change due to the cyclicity in the seasons and the rotation of the earth. Looking at the smaller one, it cycles about once per year (once up and once down).’
NOAA
20
It’s all dependent on water surface temperature. Warmer and CO2 comes out. Cooler and CO2 goes in. Summer and winter. No other effect is seen. And if there is slight water surface warming from slightly increased solar activity, the CO2 will climb slowly. CO2 is rapidly exchanged and the amount in the air is controlled by schoolboy level gaseous equilibrium and Henry’s law.
It is wasn’t for NASA’s Rocket Propulsion Laboratory James Hanson’s absurd postulation based on his studies of the atmosphere of Venus and the opportunism of Al Gore, none of this would have happened. And the world would have been so much better off without all those d*mned windmills.
101
And O2 and CO2 rapidly exchange with the thin air above. Ask any fish. They all breathe water and extract the O2. Except for whales, dolphins, seals, dugongs as mammals who have returned to the water. The fantasy pushed by warmist nutters is that CO2 is trapped and not in equilibrium, which is anti science. But you do not expect an upper atmosphere scientist like James Hansen to understand that unlike Venus, Earth is a water world.
And CO2 is highly soluble, as everyone knows. So Hanson was completely wrong and he should know it by now. The damage done by Hansen and Gore though is still wrecking Australian electricity prices and costing us billions a year in electricity payments. And Morrison like Boris Johnson want to find a middle way when it was always complete science nonsense.
111
You have to be amazed at people who just red thumb anything which challenges them but do not have the wit to disagree. It’s just ignorance. Mental graffiti posing as opinion.
80
And there lies a problem TdeF! There is no middle way .
One way or another we have to either defeat this dangerous ideology or go down fighting.
Thank God Jo is still producing this blog, which is a beacon in many ways (and thank you to the contibutors)
90
That is a much more plausible explanation.
Are there any studies /formal papers to verify or support the theory ?
10
Sadly no. Scientific papers? As said, it’s just simple schoolboy physics and physical chemistry. Man made CO2 driven global warming is just made up , almost ridiculous and clearly not true. Science fiction. Like the rapid sea rise, rapid temperature rise, endless extinctions, ocean acidification. Now bushfires no less.
All are non science rubbish. Surely after 32 years of this someone needs to say it is untrue. And therefore always was. But the so called scientists of the universities and Australia’s CSIRO say nothing. It’s more than their job’s worth to speak out. Cowards.
60
Yes , a very strong correlation.
But it is ard to believe no scientific body has declared this as even a possible theory. ?
……and Are there any worthy scientific declarations that specifically deny this as a possibility ?…….other than the usual warmist rantings !
10
Observation of the data and knowledge of CO2 water solubility with temperature is all that is needed.
Sea surface temperature:
http://climexp.knmi.nl/data/ihadisst1_0-360E_30–70N_n_2017:2019.png
Atmospheric CO2:
https://sioweb.ucsd.edu/programs/keelingcurve/wp-content/plugins/sio-bluemoon/graphs/mlo_two_years.png
10
I am a Logician, I always look things up before posting!
Check for yourselves how the instruments that measure CO2 in the atmosphere work. They use a reference source which requires re-charge/replacement.
Check the sea surface temperature short term and long term, it follows roughly a sine wave, getting colder as winter sets in and then warmer as summer arrives.
Check the phase of this change against the phase of the Mauno Loa Saw tooth waveform.
Check what the warmist’s say about CO2 transmission into and out of the Oceans. When is the level increasing and when is it decreasing?
Check if there is ANY change in CO2 concentrations at depth?
Now try explain that SUDDEN change from negative going to Positive going!
21
‘We paved paradise’, illustrated version
https://www.flickr.com/photos/149157242@N05/50340240223/in/dateposted-public/
20
Casey Base, Antarctica. minus 37*, with 240 km winds. What is the wind chill??
https://www.youtube.com/watch?v=LJoYNfV084I&t=35s
20
“REAL CLIMATE SCIENCE FROM DAVID LEGATES SEEMS TO SCARE THE MEDIA, WILL IT SCARE NOAA?”
https://wattsupwiththat.com/2020/09/13/real-climate-science-from-david-legates-seems-to-scare-the-media-will-it-scare-noaa/
20
On RetractionWatch’s site but not retracted is a paper —
COVID-19 arrived on a meteorite, claims Elsevier book chapter
From https://retractionwatch.com/2020/09/08/covid-19-arrived-on-a-meteorite-claims-elsevier-book-chapter/
20
This is a sign of imminent global cooling.
UK heatwave alert: Met Office warns of ‘dangerously hot weather’ this week.
00
“Why the Covid-19 epidemic is essentially over & current PCR testing protocols are pointless”
Links to
https://lockdownsceptics.org/addressing-the-cv19-second-wave/
https://wattsupwiththat.com/2020/09/14/why-the-covid-19-epidemic-is-essentially-over-current-pcr-testing-protocols-are-pointless/
20
Thanks. Both of those refs say-
“Cycle Threshold (Ct) obtained during the test to aid assessment of a patient’s viral load.” should be reported.
00
Morrison threatens to build a Gas Fired Generation Plant.
https://esdnews.com.au/morrison-threatens-industry-with-gas-plant/
20
As an Engineer, and a logical thinker,.. i still find this to be a rediculous proposal.
With all the resources, infrastructure, existing facilities, and experienced workforce,..already established at the Liddell site, a complete rebuild and updated Coal fired plant manke so much more sense.
But WTF has common sense got to do with Green climate madness and Politics ?
40
Documentary on ABC this evening is very compelling for families worried about Climate Change. See the Great Accelleration on iView.
00